Patient specimens

Tissue and plasma from lung cancer patients were Institutional Review Board (IRB) approved in Korea Institute of Radiological and Medical Sciences (KIRAMS). The specimens used for this study were distributed by the Korea Institute of Radiological and Medical Sciences (KIRAMS) Radiation Biobank (KRB) in Republic of Korea (KRB-2021-I002, KRB-2023-I001). The bio-specimens and data used in this study were provided by the Radiation Tissue Resources Bank of Korea Cancer Center Hospital (TB-2021-02-B/P50, C/P50, L/P40). Lung tissue was embedded in paraffin and mRNA extraction and ELISA were performed on plasma.

Chemicals

Recombinant human IL-10 protein used in the experiment was purchased from R&D Systems (MN, USA). Phorbol 12-myristate 13-acetate (PMA) was purchased from Sigma-Aldrich (MO, USA). Dimethyl amiloride (DMA) was purchased from Santa Cruz Biotechnology (TX, USA).

Cell culture

LLC1, and WI-38 cells were purchased from American Type Culture Collection (ATCC, VI, USA). U251, A549, and THP-1 cells were purchased from Korean Cell Line Bank (KCLB, Korea). A549 and THP-1 cells were cultured in RPMI 1640 media (Corning, NY, USA). U251 and LLC1 cells were cultured in DMEM (Corning, NY, USA). WI-38 cells were cultured in MEM (Welgene, Korea). All media used for cell culture were supplemented with 10% Fetal Bovine Serum (FBS, Corning, NY, USA) and 1% penicillin streptomycin (Corning, NY, USA). Cells were cultured in an incubator at 37 °C and 5% CO2.

Plasmid, miRNA mimic, and transfection

miR-6794-5p mimic, miR-6794-5p inhibitor, and cy3-tagged miR-6794-5p were synthesized by Genolution Inc. (Korea). All siRNAs against Rab27a, IL-10, SOCS1, and STAT3 purchased from Santa Cruz Biotechnology (TX, USA). The pLPC-flag-SOCS1 vector was provided by Addgene (Plasmid #129514). The Bcl-w gene was inserted into the pcDNA3.1 vector. The following primers were used for Bcl-w overexpression vector; ATGGCGACCCCAGCCTCG (forward) and TCACTTGCTAGCAAAAAAGGCCCCTA (reverse). HindIII and XhoI were used as restriction enzymes. Plasmid, miRNA, and siRNA were transfected into cells using Lipofectamine 2000 reagent (Invitrogen, MA, USA) following the manufacturer’s instructions.

Transwell-invasion and migration assays

For the invasion assay, a transwell with 8 μm pores (Corning, NY, USA) was coated with matrigel (Corning, NY, USA). The cells were seeded on the matrigel-coated transwell and filled the lower chamber with complete medium. After 16 hours, the transwell was fixed with methanol and stained with crystal violet. For the transwell migration assay, the bottom of the transwell was coated with 0.2% gelatin. Cells were seeded on the matrigel-coated transwell and filled the lower chamber with complete medium. After  16 hours, the transwell was fixed with methanol and stained with crystal violet. For the wound healing assay, 80–90% of the cells are seeded in 12-well plates. Scratch a straight line through the center of the well using a pipette tip. After 16 hours, the number of migrated cells is counted and displayed in a graph.

Sphere formation assay

The transfected U251, A549, and LLC1 cells were resuspended in Dulbecco’s modified Eagle’s medium-F12 (Gibco, MA, USA) containing B27 (Gibco, MA, USA) and grown for 7–10 days. Spheres were counted with a diameter > 20 μm under an inverted microscope (Olympus, JAPAN).

Western blot analysis

Proteins were extracted from cells using lysis buffer (10 mM Tris-HCl with pH 7.4, 150 mM NaCl, 1% NP-40, 1 mM EDTA, 0.1% SDS) containing protease inhibitors (Roche, Switzerland) and phosphatase inhibitors (Roche, Switzerland). Protein samples were separated by electrophoresis on SDS-PAGE gel and then transferred to PVDF membranes. The membrane was incubated overnight at 4 °C using the following antibodies; Rab27a (GTX109180) was purchased from Genetex (CA, USA). CD9 (EXOAB-CD9A-1), CD63 (EXOAB-CD63A-1), and TSG101 (EXOAB-TSG101–1) were purchased from System biosciences (CA, USA). Bcl-w (#2724), N-cadherin (#13116), Vimentin (#5741), Zeb1 (#3396), β-catenin (#9582), Notch2 (#5732), Oct4 (#2750), SOCS1(#3950), p-Stat3 (#9145), STAT3 (#9139), p-JAK1 (#3331), and JAK1 (#3344) were obtained from Cell signaling (MA, USA). Twist (ab50887), CD163 (ab182422), CD206 (ab64693), and CD11b (ab133357) were purchased from Abcam (UK) and β-actin(sc-47,778) was obtained from Santa Cruz Biotechnology (TX, USA). Horseradish peroxidase (HRP) conjugated secondary antibodies (Bio-rad, CA, USA) were incubated for 1 hours in room temperature.

Total RNA isolation and quantitative real-time PCR

RNA was extracted from cells and plasma using Trizol reagent (Qiagen, Germany). Complementary DNA (cDNA) was synthesized according to the manufacturer’s instructions of the SensiFAST™ cDNA Synthesis Kit (Bioline, OH, USA) and Mir-X™ miRNA First-Strand Synthesis Kit (Takara, JAPAN). Real-time PCR was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems, MA, USA). The following primers were used for real-time PCR: miR-6794-5p, CAGGGGGACTGGGGGTGAG; Oct4, AGTGAGAGGCAACCT GGAGA (forward) and ACACTCGGACCACATCCTTC (reverse); Zeb1, GCCAATAAGCA AACGATTCTG (forward) and TTTGGCTGGATCACTTTCAAG (reverse); Twist, GAAGAT CATCCCCACGCTG (forward) and AGGAAGTCGATGTACCTGGC (reverse); PRMT1, CC AGTGGAGAAGGTGGACAT (forward) and CTCCCACCAGTGGATCTTGT (reverse); BTG2, CCCTATGAGGTGTCCTACCG (forward) and AGCACTTGGTTCTTGCAGGT (reverse); LZTS1, GAGCCTCATGAAGGAGCAGG (forward) and CAGGTCCTGGGTCCT CAGCT (reverse); SZRD1, AAGTCCCTAGCACAGCGAGA (forward) and GGTTTCTCC TGCTCCTCCTC (reverse); SOCS1, TGGTAGCACACAACCAGGTG (forward) and GAG GAGGAGGAAGAGGAGGA (reverse); CD163, CCAGTCCCAAACACTGTCCT (forward) and CACTCTCTATGCAGGCCACA (reverse); CD206, ACGGACTGGGTTGCTATCAC (forward) and TGATCCCCAAAAGTGTGTCA (reverse); CD11b, ACGTAAATGGGGACA A GCTG (forward) and GATCCTGAGGTTCCGTGAAA (reverse); IL-1b, GGACAAGCTGAG GAAGATGC (forward) and TCGTTATCCCATGTGTCGAA (reverse); IL-10, CCAAGCTG AGAACCAAGACC (forward) and GGGAAGAAATCGATGACAGC (reverse); CCL17, AG CCATTCCCCTTAGAAAGC (forward) and CTGCCCTGCACAGTTACAAA (reverse); CCL22, CGCGTGGTGAAACACTTCTA (forward) and ATCTTCACCCAGGGCACTCT (reverse); CCL24, GCCTTCTGTTCCTTGGTGTC (forward) and GACCACTCGGTTCTCA GGAA (reverse); VEGF, GACAGACAGACAGACACCGCC (forward) and GAACAGCCC AGAAGTTGGACG (reverse); EGF, CCTGGGAATGTGATTGCTTT (forward) and GGCAA ACAGCAAAAATGGTT (reverse); TGFB1, GTGGAAACCCACAACGAAAT (forward) and CGGAGCTCTGATGTGTTGAA (reverse); GAPDH, CATCTCTGCCCCCTCTGCTGA (forward) and GGATGACCTTGCCCACAGCCT (reverse).

Luciferase reporter assay

The binding site of miR-6794-5p in SOCS1 3’UTR was inserted into the vector, pmirGLO dual-luciferase miRNA target expression vector (Promega, WI, USA). A549 cells, which were seeded in 24well plate, were co-transfected with miR-6794-5p, renilla and luciferase vectors. After 48 hours, luciferase activity was measured using the dual-luciferase reporter assay system (Promega, WI, USA).

Ago2-RNA immunoprecipitation

This experiment was performed using RIP-assay kit for microRNA (MBL International Corporation, MA, USA) according to the manufacturer’s instructions. Cell lysates were obtained from A549 cells transfected with miR-6794-5p. Agarose beads (Santa Cruz Biotechnology, TX, USA) immobilized with Ago2 antibody (Sigma-Aldrich, MO, USA) were added to the cell lysate to lead immunoprecipitation. RNA is isolated from the formed Ago2 antibody-agarose bead-ribonucleoprotein (RNP) complex, and the RNA level of SOCS1 is measured by real-time PCR.

Elisa

IL-10 was analyzed in THP-1-derived macrophages and patient plasma using Human IL-10 quantikine ELISA kit (R&D Systems, MN, USA). Debris was removed from the conditioned media of the cells and patient plasma by centrifugation, and then proceeded according to the manufacturer’s instructions. Absorbance is measured at 450 nm using a microplate reader.

Exosome isolation and identification

Exosomes were isolated from the conditioned media of the cells using ExoQuick-TC (System biosciences, CA, USA). Experiments were performed according to manufacturer’s instructions. The ExoQuick-TC solution was added to the medium from which cell debris was removed by centrifugation and stored overnight at 4 °C. The supernatant was removed by centrifugation, and an exosome pellet was obtained. Analysis of the isolated exosomes was performed using a Hitachi H-7600 Transmission Electron Microscope (Hitachi, JAPAN). SeraMir Exosome RNA Purification Column Kit (System biosciences, CA, USA) was used to extract RNA from exosomes. Western blot analysis samples for detecting the expression of exosome markers were prepared by adding RIPA buffer containing protease inhibitors to exosome pellets.

In vivo assay

LLC1 cells overexpressing NC or anti-miR-6794-5p were subcutaneously injected into the right flank of 6-week-old Balb/c nude female mice. Cells were injected at 5 × 105 cells per mice. Based on the day of injection, they were sacrificed 2 weeks later. The tumor volume was measured width and length and calculated as (width × width × length)/2. LLC1 cells overexpressing NC, miR-6794-5p, or miR-6794-5p + SOCS1 were injected into the tail vein of 6-week-old C57BL/6 female mice. Cells were injected at 2 × 105 cells per mice. Based on the day of injection, they were sacrificed 3 weeks later. Lung tissues were fixed with formaldehyde and made into paraffin blocks. LLC1 cells overexpressing NC or miR-6794-5p mimics were subcutaneously injected into the right flank of 6-week-old C5BL/6 female mice. Cells were injected at 2 × 105 cells per mice. Based on the day of injection, they were sacrificed 2 weeks later. The tumor tissues were analyzed by flow cytometry. RNA was extracted from plasma separated from blood. These studies were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of Korea Institute of Radiological & Medical Science.

Hematoxylin and eosin (H&E) and immunohistochemistry (IHC) staining

Lung tissue fixed in 4% formaldehyde was embedded in paraffin. Paraffin sections are deparaffinized and hydrated. For H&E staining, paraffin sections were stained with Hematoxylin (Dako, CA, USA) and eosin (Epredia, NH, USA). For IHC, paraffin sections were subjected to Target retrieval solution (Dako, CA, USA), and endogenous peroxidase was blocked using H2O2. Antibodies used in IHC were CD206 (Abcam, UK), SOCS1 (Genetex, CA, USA). After reacting with biotinylated secondary antibody, DAB staining is performed. The signal was detected using cellSens (Olympus, JAPAN).

Fluorescence image analysis

Cells were transfected with cy3-tagged miR-6794-5p (Genolution, KOREA), cultured, and fixed with 4% paraformaldehyde solution. The cell morphology was confirmed by brightfield, and the fluorescence of cy3 expressed in the cells was measured using an INCELL2000 analyzer (GE Healthcare, IL, USA).

Flow cytometry

For flow cytometry, tumor tissues harvested from mice were prepared using a Tumor dissociation kit (Miltenyi biotec, Germany) according to the manufacturer’s instructions. All antibodies used in the flow cytometer were purchased from Biolegend (CA, USA). Single cells were stained with the following antibody; Zombie NIR™ fixable viability kit (423105), FITC anti-mouse I-A/I-E antibody (107605), PE anti-mouse F4/80 antibody (123109), PE/Cyanine7 anti-mouse/human CD11b antibody (101215), APC anti-mouse CD206 (MMR) antibody (141707), and Brilliant violet 510™ anti-mouse CD45 antibody (103137). Samples were acquired with a CytoFLEX flow cytometer (Beckman Coulter, CA, USA).

MiRNA microarray analysis

MiRNA microarray analysis was performed using exosomes isolated from the conditioned media of U251 cells overexpressing control vector and Bcl-w. MiRNA microarray analysis was provided by MACROGEN (Korea). The Affymetrix Genechip miRNA array process was performed according to the manufacturer’s protocol. Comparative analysis between test and control samples was performed using fold change all statistical tests. Visualization of differentially expressed genes was performed using the R statistical language v. 2.15.0.