Mice and in vivo treatment

The Advillin-Cre (Avil-Cre) mouse strain was kindly provided by Xingzhong Dong (The Johns Hopkins University, Baltimore, MD). The Osteocalcin-Cre (Ocn-Cre) mice were obtained from Thomas J. Clemens (The Johns Hopkins University). The TrkAfl/fl mice were obtained from David D. Ginty (Harvard Medical School, Boston, MA). The EP4fl/fl mice were obtained from Brian L. Kelsall (National Institutes of Health, Bethesda, MD). The COX2fl/fl mice were provided by Harvey Herschman (University of California, Los Angeles). The AgRP-IRES-Cre mice were purchased from the Jackson Laboratory (012899, Bar Harbor, ME). Heterozygous male Avil-Cre mice (female Avil-Cre mice were not used for breeding because of the risk of leakage of TrkA protein into the eggs) were crossed with a TrkAfl/fl, EP4fl/fl mouse. The offspring were intercrossed to generate the following genotypes: Avil-Cre (Cre recombinase expressed driven by Advillin promoter), Avil-Cre::EP4fl/fl (conditional deletion of the EP4 receptor in Advillin lineage cells, referred to as EP4Avil–/– in the text), Avil-Cre::TrkAfl/fl (referred to as TrkAAvil–/– in the text). Heterozygous Ocn-Cre mice were crossed with COX2fl/fl mouse. The offspring were intercrossed to generate the following genotypes: Ocn-Cre, COX2fl/fl, Ocn-Cre::COX2fl/fl (referred to as COX2Ocn−/− in the text) mice. The genotypes of the mice were determined by PCR analyses of genomic DNA, which was extracted from mouse tails within the following primers: Avil-Cre: forward: CCCTGTTCACTGTGAGTAGG, reverse: GCGATCCCTGAACATGTCCATC, WT: AGTATCTGGTAGGTGCTTCCAG; Ocn-Cre: forward: CAAATAGCCCTGGCAGATTC, reverse: TGATACAAGGGACATCTTCC; EP4 loxP allele forward: TCTGTGAAGCGAGTCCTTAGGCT, reverse: CGCACTCTCTCTCTCCCAAGGAA； TrkA loxP allele forward: AACAGTTTTGAGCATTTTCTATTGTTT, reverse: CAAAGAAAACAGAAGAAAAATAATAC; COX2 loxP allele forward: AATTACTGCTGAAGCCCACC, reverse: GAATCTCCTAGAACTGACTGG. All mice were maintained at the animal facility of The Johns Hopkins University School of Medicine (Baltimore, MD). We obtained whole blood samples by cardiac puncture immediately after euthanasia. Serum was collected by centrifuge at 1 500 r/min for 15 min and stored at −80°C before analyses. Mice bones, brains were also collected.

The drugs and compounds used in this study are as follows: Clozapine N-oxide (CNO, 4936, Tocris, Minneapolis, MN). Dosages and time courses are noted in the corresponding text and figure legends.

Hindlimb unloading model

When performing hindlimb unloading of mice, place the animals in a bright and clean room. In order to protect the hair on the tail of the mouse, we first gently wrap the tail of the mouse with a sterile dry cotton ball, and then use a soft tape to warp the tail. The tape and the cage were fixed so that the mouse’s front paws could touch the bottom of the cage so that it could eat and drink freely, while the back paws were completely off the ground. This state lasts for 4–5 h every day, and the entire process takes a total of 7 days. It is worth mentioning that we put two mice in a mouse cage at the same time for the experiment, in order to prevent them from developing depression due to long-term hindlimb unloading experiments.

Mechanical loading

Mechanical loading of 12‐week‐old male mice was performed as previously described60. Briefly, the mice were anesthetized with isoflurane (Forane, Baxter International Inc., Deerfield, IL) for the duration of the experiment. The left tibia was axially compressed by fixing the knee and ankle into molded cups on the electromagnetic mechanical actuator (ElectroForce 5500, TA Instruments, New Castle, DE). Loading was applied with a continuous 2‐Hz sinusoidal waveform ranging from 2‐N compressive loading and a 12‐N peak loading for 100 cycles per day on five consecutive days per week. The right tibia served as the internal control. Unrestricted cage activity was allowed between loading bouts. For the time‐course experiments, mice were euthanized after one week or one month of loading (n = 5–9 per group). μCT analyses were performed on the mice in the one month loading group.

Ankle osteoarthritis model

The AOA (Ankle Osteoarthritis) mouse model was established as previously described61,62. Briefly, 4-month-old C57BL/6 female mice (Jackson Laboratory) were anesthetized and underwent AOA or a sham operation of right paw. Postoperative care consisted of an injection of 5.0 mg/kg carprofen (Rimadyl; Zoetis Inc, Parsippany-Troy Hills, NJ) diluted with saline, time under a warming lamp, and visual monitoring at least once every 24 h for 72 h. A 12.5-mg carprofen tablet was administered for pain management, no additional medication was needed. All animals were maintained at the animal facility of the Johns Hopkins University School of Medicine. We obtained whole blood samples by cardiac puncture immediately after euthanasia. Serum was collected by centrifuge at 1 500 r/min for 15 min and stored at −80°C before analyses. Talus of the mice were also collected.

CatWalk analysis

Gait parameters of freely moving mice were measured using the CatWalk gait analysis system (Noldus Information Technology) as described previously34. Briefly, the CatWalk instrument consists of an enclosed walkway with a glass plate floor, a fluorescent lamp that emits light inside the glass plate, a highspeed color video camera, and recording and analysis software to assess the gait of rodents. Each mouse was placed individually in the CatWalk walkway and allowed to walk freely and traverse from one side to the other of the walkway. Mice were trained 3 times before the test. The recordings were made when the room was completely dark, except for the light from the computer screen. Where the mouse paws made contact with the glass plate, light was reflected down and the illuminated contact areas recorded with a high-speed color video camera that was positioned under the glass plate and connected to a computer running the CatWalk software, v7.1. The software automatically labeled all areas containing pixels above the set threshold (7 pixels). These areas were identified and assigned to the respective paws. The recording generated a wide range of parameters, the following 7 of which were analyzed: paw pressure, paw print area, stance phase, swing phase, duty cycle, stride length, and swing speed.

Stereotaxic injections and neural tracer labeling

Male mice at least 6 weeks of age were anaesthetized with isoflourane, then placed into the stereotaxic apparatus (Stoelting Instruments). The skull was exposed via a small incision and small holes were drilled on skull for viral or tracer injections. A pulled glass pipette with 20–40 μm tip diameter was inserted into the brain for virus or dye delivery. Briefly, 200 nL unilateral injections of pAAV-hSyn-DIO-hM4D(Gi)-mCherry (44362, Addgene) were made in the ARC of AgRP-Ires-Cre mice (coordinates, bregma: anterior-posterior, −1.50 mm; dorsal-ventral, −6.00 mm; lateral, ±0.20 mm). For anterograde tracing, 500 nL unilateral injections of AAV9-hSyn-GFP (SL116013, SignaGen) were made in the ARC of C57BL/6 mice (coordinates, bregma: anterior-posterior, −1.50 mm; dorsal-ventral, −6.00 mm; lateral, ±0.20 mm). For retrograde labeling, 200 nL unilateral injections of cholera toxin subunit B (CTB-Af488, C34775, Invitrogen) were made in the PVN of C57BL/6 mice (coordinates, bregma: anterior-posterior, −0.80 mm; dorsal-ventral, −4.90 mm; lateral, ±0.25 mm). Postoperative analgesia was provided (ketoprofen, 5 mg/kg). Mice were allowed 1 week to recover and then acclimated to handling for 1 week before the start of any in vivo studies.

μCT analyses

μCT analyses were performed on the mice in the one month loading group. Mouse bones were harvested, and the soft tissue around the bone was removed, followed by fixation overnight using 4% paraformaldehyde. μCT analyses were performed using a high-resolution μCT scanner (1174, SkyScan, Bruker, Kontich, Belgium). The voltage of the scanning procedure was 65 keV with a 153-μA current. The resolution was set to 9 μm/pixel. Images were reconstructed using NRecon, version 1.6, software (SkyScan) and analyzed using CTAn, version 1.9, software (SkyScan). We used 3-dimensional model visualization software, CTVol, version 2.0 (SkyScan), to analyze the diaphyseal cortical bone and the metaphyseal trabecular bone parameters of the bone. We created cross-sectional images of the femur to perform 2-dimensional analyses of cortical bone and 3-dimensional analyses of trabecular bone. The regions of interest were defined to cover the whole sagittal plane for talus and 0.45 mm in length centered 3 mm proximal to the distal distal tibiofibular junction (TFJ) for tibia, and 0.5 mm in length extended from 0.25 mm distal to the growth plate level in the direction of the metaphysis. The trabecular bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N) were collected from the 3-dimensional analysis data and used to represent the trabecular bone parameters. 2D structural analyses of cortical bone area (Ct.Ar) and cortical thickness (Ct.Th) were collected to represent cortical bone parameters.

Histochemistry, immunohistochemistry and immunofluorescence assay

The samples were sectioned at 4 μm or 40 μm intervals using a Microm cryostat (for frozen blocks) or a Paraffin Microtome (for paraffin blocks). We processed 4-μm-thick sections of bone for H&E staining and safranin o (Sigma-Aldrich, S2255) and fast green (Sigma-Aldrich, F7252) staining. TRAP staining was processed following the manufacturer’s protocol (Sigma-Aldrich, 387A-1KT), followed by counterstaining with Methyl Green (Sigma-Aldrich, M884). Briefly, the bone samples were fixed for 4 h with 4% paraformaldehyde at 4 °C and then decalcified at 4 °C using 0.5 mol/L EDTA (pH, 7.4) for 24 h with constant shaking. The samples were dehydrated in 20% sucrose and 2% polyvinylpyrrolidone solution for 24 h and embedded in 8% gelatin (G1890, Sigma-Aldrich) in the presence of 20% sucrose and 2% polyvinylpyrrolidone. Forty μm–thick coronal-oriented sections of bone samples were obtained. For brain section preparation, the whole brain was collected from euthanized mice and fixed with 4% paraformaldehyde for 30 min. Then, the tissue was dehydrated with 20% sucrose for 24 h, followed by 30% sucrose for 24 h and sectioned.

Immunostaining was performed using standard protocol. Briefly, the sections were incubated with primary antibodies to mouse osteocalcin (1:200, M173, Takara Bio), COX2 (1:100, ab15191, Abcam), CTSK (1:200, PA5-102483, Thermo), CGRP (1:100, ab81887, Abcam), pCREB (1:100, ab32096, Abcam), TH (1:200, AB152, Sigma) overnight at 4 °C. A horseradish peroxidase–streptavidin detection kit (Dako, Agilent, Santa Clara, CA) was used in immunohistochemical procedures to detect immuno-activity, followed by counterstaining with hematoxylin (S3309, Dako). Fluorescence-conjugated secondary antibodies were used in immunofluorescent procedures to detect fluorescent signals after counterstaining with DAPI (H-1200, Vector, Burlingame, CA). We used a LSM 780 confocal microscope (Zeiss, Oberkochen, Germany) or an Olympus BX51 microscope (Olympus, Tokyo, Japan) for sample image capturing. Quantitative histomorphometric analysis was performed by using OsteoMeasure XP software (OsteoMetric, Decatur, GA) in a blinded fashion.

ChIP

ChIP was performed according to instructions from the Pierce Agarose ChIP Kit (26156, Thermo Fisher Scientific, Waltham, MA) with ChIP-grade antibody CREM (sc-390426, Santa Cruz Biotechnology), pSTAT3 (9145, Cell Signaling Technology). Briefly, we added cells with formaldehyde to cross-link proteins to DNA, and the cells were lysed in 1.5-mL lysis buffer (50 mmol/L HEPES, pH 7.5, 140 mmol/L NaCl; 1 mmol/L EDTA; 1% Triton X-100; 0.1% sodium deoxy cholate; 0.1% sodium dodecyl sulfate). Cell lysates were sonicated at 2 s on/15 s off for 3 rounds using a Bioruptor ultrasonic cell disruptor (Diagenode, Denville, NJ) to shear genomic DNA to a mean fragment size of 150 to 250 bp. Of the sample, 1% was removed for use as an input control. ChIP was performed according to the protocol provided by the Simple Chip Enzymatic Chromatin IP Kit (Cell Signaling Technology) using antibodies. Anti-RNA polymerase II and control IgG were used as positive and negative controls, respectively. After washing and de-crosslinking, the precipitated DNA was purified using a QIA quick PCR purification kit (Qiagen, Hilden, Germany).

Quantitative real-time polymerase chain reaction (qPCR)

Total RNA was purified from tissues using TRIzol (15596026, Invitrogen, Carlsbad, CA) following the manufacturer’s protocol. CREM primer: 5’-ATGGCTGTAACTGGAGATGAA-3’ (forward) and 5’-GTGGCAAAGCAGTAGTAGGA-3’ (reverse). We performed qPCR using the Taq SYBR Green Power PCR Master Mix (A25777, Invitrogen) on a CFX Connect instrument (Bio-Rad Laboratories, Hercules, CA); Gapdh amplification was used as an internal control. Dissociation curve analysis was performed for every experiment. Sequences of the primers used for each gene are available on request.

ELISA and Western Blot

PGE2 concentrations in the bone marrow were determined by PGE2 ELISA kit (Cayman Chemical, 514010) according to the manufacturer’s protocol. We euthanized mice, collected the bones from different parts. The spine was taken from the fourth to fifth lumbar vertebrae. We collected the complete femur and tibia to measure the overall content of PGE2 in both the femur and tibia. Additionally, we separately collected the trabecular, cortical, and cancellous bone from the femur, as well as the subchondral bone from the tibia, to assess the content of PGE2 in different areas. Then we centrifuged the samples for 15 min at 800 × g at 4 °C to obtain bone marrow supernatants, which were stored at –80 °C until ELISA.

Western blot analyses were conducted on the protein of lysates from the hypothalamus of mice. The supernatants of lysates were collected after centrifugation and separated by sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE), and then blotted on the nitrocellulose blotting membranes (MilliporeSigma, Burlington, MA). The primary antibody for CREM (1:1 000, sc-390426, Santa Cruz Biotechnology) and β‐Actin (1:3 000, A2228, Sigma) was applied for incubation.

Statistical analysis

All data analyses were performed using SPSS, version 15.0, software (IBM Corp., Armonk, NY). Data are presented as means ± standard errors of the mean. For comparisons between 2 groups, we used 2-tailed Student t-tests. For comparisons among multiple groups, we used 2-way analysis of variance. All relevant data are available from the authors.

Study approval

All human samples were obtained from patients undergoing total talus replacement surgery in the Department of Orthopedics Surgery at JHU Hospital. The patients’ consent, as well as approval of the local ethics committees, were obtained before harvesting human tissue samples. The experimental protocol was reviewed and approved by the Institutional Animal Care and Use Committee of Johns Hopkins University.

All animal experiments were performed in accordance with NIH policies on the use of laboratory animals. All experimental protocols were approved by the Animal Care and Use Committee of The Johns Hopkins University.