DNA (cDNA) and mRNA microarray analysis

Total RNA from si-PGR AsPC-1 and Ctrl-PGR AsPC-1 cells were prepared using TRIzol (Invitrogen, USA). The cDNA and mRNA microarray analyses were performed by Shanghai Biotechnology Corporation. The uploaded data is accessed in GSE228301.

Cell lines, animals, and clinical samples

Human pancreatic cancer cell lines Capan-1, PANC-1, SW 1990, Patu8988, and MIA PaCa-2 were cultured in DMEM-High glucose (BasalMedia, China) media, and AsPC-1, BxPC-3, and CFPAC-1 were maintained in RPMI 1640 Medium (BasalMedia, China). These cell lines were all preserved at Shanghai Cancer Institute, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University. The culture medium was supplemented with 1% penicillin-streptomycin (Pen-Strep) (BasalMedia, China) and 10% fetal bovine serum (FBS) (Dcell biologics, China). siRNA duplexes targeting human PGR purchased from GenePharma Company were transfected into cells for 48 h utilizing jetPRIME Polyplus Transfection reagent (Amazon, USA) according to manufacturer’s instructions. The siRNA sequences primer of PGR is listed in Supplementary Table 1. The conditional LSL-KrasG12D/+; LSL-Trp53R172H/; Pdx1-Cre (KPC) mice were described previously [2]. BALB/c nude mice used for tumor model establishment were ordered from Shanghai JieSiJie. Animal care and the protocols were carried out by the Guide for the Care and Use of Laboratory Animals prepared by the National Academy of Sciences and published by the NIH (Bethesda, MD). The tumor tissues and non-tumoral adjacent tissues microarray were commercially available. This study was approved by the Ethics Committee of Renji Hospital, Shanghai Jiao Tong University School of Medicine.

Chromatin immunoprecipitation assay (ChIP-PCR) and PCR analysis

Pancreatic tumor cells (AsPC-1 and Capan-1 cell) transfected with the plasmids of Flag-tagged PGR were prepared for a ChIP assay using a ChIP assay kit (56383 S, Cell Signaling Technology) according to the manufacturer’s protocol. Briefly, PDAC cells were incubated with 1% formaldehyde in the cultured medium for 15 min at room temperature and quenched the reaction using glycine for 5 min. After nuclei preparation and chromatin fragmentation, anti-Flag M2 (2 µg, Sigma-Aldrich, F1804), Histone H3 (2 µg, Cell Signaling, 4620S), or mouse IgG (2 µg, Cell Signaling, 5415S) antibodies were added to prepared IP samples overnight at 4 °C. Immunoprecipitated DNA was purified using a DNA purification kit (Cell Signaling, 14209S). The resulting precipitated DNA samples were analyzed using PCR to amplify a region of the CDC42 promoter with the forward primer 5′- GTGGTTGGGGGAAGGTTGT -3′ and reverse primer 5′- GGAAGCTTCTCTGAAAGGGCTG -3′ (Supplementary Table 2). The PCR products were resolved electrophoretically on a 2% agarose gel and visualized by (Gel image analysis system, Shanghai Furi).

Luciferase reporter gene assay

Cells were transfected with the indicated CDC42 promoter reporters, siRNAs, or specific gene expression plasmids. The luciferase activity in the cells was quantified using a luciferase assay system 24 h after transfection.

Ex vivo macropinocytosis assay

For the detection of macropinocytosis in tumors, freshly cut cross-section slices of tumors were subjected to injection (150 μL) and immersion with 10-kDa TMR-dextran (4 mg/mL) at room temperature for 15 minutes. The tissue was rinsed twice in PBS and immediately frozen in optimal cutting temperature (O.C.T.) compound. Tissue processing and image analysis were performed as previously described [56].

Immunohistochemical and immunofluorescence analysis

For IHC analysis, tissues of xenograft tumors were collected and fixed in 10% formalin followed paraffin embedded and cut into 4-μm sections. Sections from the resected pancreas of KPC mice, xenograft tumors, tissue microarrays, and tumors of human patients with PDAC were conducted and stained for the study purpose. Images were acquired byDigital Slide Scanner (Leica Microsystems, Germany) and analyzed by ImageJ. Engaged antibodies: anti-PGR (8757S, Cell Signaling Technology), anti-PGR (25871-1-AP, Proteintech), and PCNA (GB11010, Servicebio). The IHC score was conducted based on the percentage of positive-stained cells: 0–5% scored 0, 6–35% scored 1, 36–70% scored 2, and more than 70% scored 3. The staining intensity was defined as below: no staining = 0, weakly staining = 1, moderately staining = 2, and strongly staining = 3. The total IHC score was obtained by multiplying the score of intensity and that of percentage score. We defined the total IHC as follows: “-” for a score of 0–1, “+” for a score of 2–3, “++” for a score of 4–6 and “+++” for a score of >6. The samples of “-” and “+” were defined as low expression and the samples of “++” and “+++” were defined as high expression. In the analysis between carcinoma and para-cancerous samples in TMA, a score was assigned to each sample. Samples with a higher score in the carcinoma group were classified as up-regulated, samples with a lower score in the carcinoma group were classified as down-regulated, and samples with the same score were classified as no-change.

For IF analysis of PDAC cells, cells were fixed with 10% (vol/vol) neutral-buffered formalin for 10 min and permeabilized with 0.5% Triton X-100 for 5 min. After blocking with 5% BSA in PBS, the cells were stained with primary antibody, anti-active CDC42 (26905, NewEast Bioscience), overnight at 4 °C and Alexa Fluor 488 secondary antibody (A0423, Beyotime) diluted in 1% BSA for 1 h at room temperature in dark. The cells were then stained with 1 μg/ml DAPI for 30 min to visualize nuclei.

For macropinocytosis detection, cells were seeded on slides and starved in the serum-free medium for 12–18 h. 1 mg/mL TMR-dextran (70 kDa, Thermo Fisher, USA) dissolved in serum-free medium was used for 30 min staining at 37 °C. After incubation, the nuclei were stained by DAPI for 30 min at RT. The samples were examined under Leica confocal microscope (Leica Microsystems, Germany).

Cell proliferation assay, colony formation

For cell proliferation assay, PDAC cells were plated in 96-well plates at 3000 cells per well and performed using the cell counting kit-8 (CCK-8, Share-Bio, China) according to the manufacturer’s instructions. For detection of the effect of macropinocytosis on cell proliferation, the macropinocytosis inhibitor 5-[N-ethyl-N-isopropyl] amiloride (EIPA) (MCE, China) of 0.5, 1, 2, 5 μM were added respectively in PGR overexpression cells. For colony formation assay, Cells were plated in 6-well plates at 1000 cells per well and colonies were stained with 0.5% crystal violet staining solution after 14 days. The fresh medium was replaced every 3 days.

Wound healing assay

To assess cell migration, the wound healing assay was performed. Cells at 5 × 105 per well were seeded in six-well plates and treated with plasmid transfection, antagonist, or agonist as figure legend described. After cells grew to 85–95% confluence, we used a 200-μl pipette tip to make a vertical wound and followed three washes with PBS to remove excess cells. Images of the wound were acquired under an inverted microscope (Zeiss AXIOVERT 200) at 0, 24 h.

Subcutaneous tumor models

BALB/c nude mice (Female, 4-6 weeks of age; Shanghai JieSiJie) were randomly divided in two group and injected subcutaneously with 2 × 106 sh-PGR and wild-type Capan-1 cells at the left flanks. At every 5 days, a subcutaneous intraperitoneal injection of gemcitabine (50 mg/kg) was given to each mouse in the control group and sh-PGR group. After 35 days of post-cell injection, the mice were killed, tumors were excised, and their sizes were measured.

Western blot analysis

Whole-cell lysates containing equal protein sample loading were used to perform western blot analysis and the protein expression was normalized to β-Actin or GAPDH. The western blot results were quantitated using ImageJ software. The specific antibodies used in western blot were anti-PGR (8757S, Cell Signaling Technology), anti-PGR (25871-1-AP, Proteintech), anti-Beta Actin (81115-1-RR, Proteintech). HRP-conjugated secondary antibodies were obtained from ShareBio (SB-AB0101, SB-AB0102). The agonist and antagonist treatments of PGR were Medroxyprogesterone acetate (M5764, AbMole, USA), and Mifepristone (M3510, AbMole, USA) of 10 μM for 24 h, respectively.

5-Ethynyl-2′-Deoxyuridine Incorporation Assay

The 5-ethynyl-2′-deoxyuridine (EdU) incorporation assay was performed using BeyoClick EdU-488 Cell Proliferation Kit (#C0071S, Beyotime), following the manufacturer’s instructions. Cells were seeded on the 8-well chamber and allowed to grow overnight. Then, cells were added medium containing EdU (10 µM) for 2 h incubation, fixed by 4% formaldehyde for 15 min, and permeabilized with 0.3% Triron X-100 in PBS. After PBS wash, cells were incubated with Click reaction cocktail at room temperature for 30 min, followed by nuclei staining with DAPI for 30 min. The images were captured by a Leica Fluorescence Microscope.

Bioinformatic processing of TCGA and GEO data

Transcriptome data of PDAC patients were obtained from TCGA database and GEO database. After downloading the count matrix, data was normalized using the trimmed mean of M-values (TMM) method. Differentially expressed genes (DEGs) were analyzed using the limma package and identified based on FDR cutoff of 0.05 and a fold change threshold of 2.0. The results were visualized using the ggplot2 package.

Enrichment analysis

Gene Ontology (GO) and Reactome enrichment analysis of DEGs were performed with the cluster Profiler R package. Terms with a p-value < 0.05 were identified as statistically enriched.

Statistical analyses

Statistical analyses were performed in GraphPad Prism 9.0 and R software. Statistical significance between groups was calculated by Student’s t-test or one-way ANOVA. Kaplan–Meier analysis with the log-rank test was used to analyze overall survival. Data were expressed as mean ± SD (ns p > 0.05; *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001).