Study participants

The study conducted in the West China Second University Hospital involved a 36-year-old Han Chinese man, who had been diagnosed with infertility for 2 years. His sperm phenotype abnormalities were diagnosed at least twice and verified by semen analysis according to the World Health Organization’s (WHO) laboratory manual for the examination and processing of human semen (2021) [20]. To serve as the population study’s normal controls, 200 unrelated Han Chinese males were selected from among volunteers who had fathered at least one offspring through natural fertilization. In addition, 150 infertile individuals were recruited to determine the frequency of ZCWPW1 variants in a sporadic male sterile population by whole‑exome sequencing (WES). The man’s parents were also involved in the study and they have no consanguinity. Oral pharyngeal swabs genomic DNA of his parents were collected for genetic analysis. The obstructive azoospermia patients provided the testicular puncture samples as the normal controls. This study was conducted according to the tenets of the Declaration of Helsinki and approved by the Ethical Review Board of West China Second University Hospital, Sichuan University. Before sample collection, each subject signed a written informed consent.

WES and Sanger sequencing

Whole-blood samples from the proband and 150 infertile individuals were collected for WES. The genomic DNA was extracted from these samples using the FitAmp Plasma/Serum DNA Isolation Kit (P-1004-2, Epigentek) [21]. The SureSelect Human All Exon V6 Kit (5190–8865, Agilent Technologies) was used for exon capture according to the manufacturer’s protocol and sequencing was performed on the Illumina HiSeq X system [22]. ANNOVAR was utilized for functional annotation [22,23,24,25], followed by filtering of data using 1000 Genomes Project, gnomAD, and ExAC [26,27,28]. SNVs, SIFT, PolyPhen-2, M-CAP and CADD were employed to predict the functional consequences of the retained nonsynonymous [29,30,31,32,33]. The candidate variants should have a population frequency of less than 1/1000 and a minor allele frequency of less than 0.05. And bioinformatics functional analysis of included variants should be consistent with being deleterious or potentially deleterious. Oral pharyngeal swabs of his parents were collected for genetic validation of recessive inheritance of the candidate variant. The genomic DNA from the oral pharyngeal swab was extracted by using a rapid genomic DNA extraction kit for oral/pharyngeal swabs (D310, Aidlab Biotechnologies). Sanger sequencing was used to validate the candidate pathogenic variant detected in the patient and both of his parents. PCR amplification was performed using the ProFlex PCR System (Thermo Fisher) and DNA sequencing of PCR products was conducted on a DNA sequencer (ABI377A, Applied Biosystems). The ZCWPW1 variant identified by WES was verified by Sanger sequencing. The PCR primers were as follows:

F: 5ʹ TTGTGTTCTGTTCATCTAACCCCTT 3ʹ;

R: 5ʹ GCCTGACTCATCTACCCTACCCTCG 3ʹ.

Papanicolaou staining

Semen samples were carefully spread onto slides, air-dried, and fixed with 95% (volume/volume) ethanol for no less than 15 min. Following this, the slides were treated to a graded series of ethanol concentrations (50%, 80%, 95%) and stained sequentially with Harris’s haematoxylin (nuclei staining), acidic ethanol (decolorization), G-6 orange stain (non-squamous cytoplasm staining), and EA-50 green stain (cytoplasm staining), following the guidelines outlined by the World Health Organization [20]. The stained semen smears were mounted using permount TM mounting medium (MM1411, MKBio), enabling the preservation of the smears for further analysis under a microscope.

Electron microscopy

The fresh sperm samples were prepared for electron microscopy using both scanning electron microscopy (SEM) and transmission electron microscopy (TEM) assays.

For SEM, the samples were fixed onto slides using 2.5% glutaraldehyde (as a fixative, preserving the structure and form of samples) and refrigerated overnight at 4 °C. The slides were rinsed with 1 × PBS buffer three times. Then gradually dehydrated with an ethanol gradient (30, 50, 75, 95, and 100% ethanol), which gradually remove water from the sample while preserving its structure, preparing it for further processing and imaging. The samples were then dried by a CO2 critical-point dryer (drying samples while preserving their structure) and sputter-coated by an ionic sprayer meter (Eiko E-1020, Hitachi). Finally, the samples were observed using SEM (S-3400, Hitachi).

For TEM, samples were washed three times with SpermRinse™ (10,101, Vitrolife), fixed in 3% glutaraldehyde, phosphate-buffered to pH 7.4, and postfixed with 1% OsO4. The cells were embedded in Epon 812, and ultrathin sections were stained with uranyl acetate (negative staining, providing contrast to the sample and making it easier to visualize the fine details of the specimen) and lead citrate (positive staining, visualizing cellular organelles and other subcellular structures in samples). High-quality imaging of the samples was performed under a TEM (TECNAI G2 F20, Philips) with an accelerating voltage of 120 kV.

Isolation of human spermatogenic cells

The obstructive azoospermia patients provided the testicular puncture samples as the normal controls. The cell density-gradient centrifugation technique was performed using the STA-PUT velocity sedimentation method, as previously described [34, 35]. Briefly, spermatogenic cells of humans extracted from testis biopsies undergone the first digestion using 2 mg/ml collagenase IV (17104019, Gibco) and 1 μg/μl DNase I (18047019, Invitrogen). Then secondly digested by 4 mg/ml collagenase IV, 2.5 mg/ml hyaluronidase (H3506, Sigma), 2 mg/ml trypsin (T1426, Sigma) and 1 μg/μl Dnase I. Last, the samples were loaded in an STA-PUT velocity sedimentation cell separator (ProScience) for gradient separation. This method efficiently separates sperm cell populations by density, enabling the isolation and analysis of specific cell types.

Immunofluorescence staining

For the analysis of spermatogenic cells and sperm, samples were fixed in 4% paraformaldehyde for 30 min, permeabilized with 0.3% Triton X-100 (HFH10, Invitrogen) for 15 min, and blocked with 10% donkey serum (C2540-0100, VivaCell) for 1 h at room temperature. The samples were then incubated overnight at 4 °C with primary antibodies against ZCWPW1 (1:2000; 165445, NovoPro), α-Tubulin (1:10,000; AC012, ABclonal), Peanut agglutinin (PNA) (1:100; L32459, Invitrogen), followed by incubation with Alexa Fluor 488 (1:1000; A21206, Thermo Fisher Scientific) or Alexa Fluor 594 (1:1000; A11005, Thermo Fisher Scientific)-labeled secondary antibodies at room temperature. Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (D9542, Sigma-Aldrich).

For testicular tissues, samples were fixed in 3.7% buffered formaldehyde and embedded in paraffin. After the tissue sections were deparaffinized in xylene and rehydrated in a graded series of alcohols, they were treated with 3% hydrogen peroxide and 20 mM sodium citrate. Then, they were blocked with donkey serum, incubated with primary antibodies overnight at 4 °C, and with secondary antibodies and DAPI for 1 h at 37 °C. Finally, images were captured using a confocal microscope (FV3000, Olympus Corporation). The relative intensity of immunofluorence was quantified with ImageJ software (NIH) and used for statistical analysis.

Real-time polymerase chain reaction

The RNA of the several tissues of mouse was extracted from Trizol reagent (15596026, Invitrogen). The cDNA was obtained using a RevertAid First-Strand cDNA Synthesis Kit (K1621, Thermo Fisher Scentific) following the protocol. Real-time PCR was performed using the TB Green Premix Ex Taq II (CN830S, TaKaRa).

The primers for mouse ZCWPW1 were as follows:

F: 5ʹ-GGAGGAGAAGGAGGAGGAAGAA-3ʹ,

R: 5ʹ-CAGTGTGGGTACAGGAGGGACT-3ʹ;

The primers for mouse Gapdh were as follows:

F: 5ʹ-GGTGAAG GTCGGTGTGAACG-3ʹ,

R: 5ʹ-CTCGCTCCTGGAAGATGGTG-3ʹ.

Western blotting

The proteins from the cultured cell were extracted with the RIPA Lysis buffer (P0013B, Beyotime) and proteinase inhibitor cocktail (04693132001, Roche). The protein was obtained from cell lysis after centrifugation of 15,000 × g for 15 min. Then added SDS sample loading buffer (P0015, Beyotime) and the samples were boiled at 95 °C for 10 min. The concentration of the proteins was measured by BCA kit (P0011, Beyotime) following the manufacturer’s instructions. After denaturation, 40 μg protein was loaded in each lane. Proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred to a polyvinylidene difluoride membrane (IPFL00010, Millipore). The membranes were incubated with the instant blocked buffer (SW3012, Solarbio) for 20 min. Then the membranes were incubated with the primary antibody, Flag antibody (1:10,000; PTM-6075, PTM Bio), γ-H2AX (1:500; AP0687, ABclonal), H3K4me3 (1:500; A22146, ABclonal), H3K36me3 (1:500; A20379, ABclonal) and H3K9ac (1:500; A7255, ABclonal) with proper dilutions overnight at 4 ℃. Next, the membrane was incubated with goat anti-mouse IgG secondary antibody-HRP (1:2000; 32230, Thermo Fisher Scientific) or goat anti-rabbit IgG secondary antibody-HRP (1:2000; 6120, Thermo Fisher Scientific) at room temperature for 1 h. Finally, the blots were soaked with enhanced chemiluminescence (32209, Thermo Fisher Scientific) and were captured by the Chemidoc MP Imaging System (Bio-Rad). The grayscale analysis of protein bands was quantified with ImageJ software (NIH) and used for statistical analysis.

Cell culture and transfection

HEK293t and Hela cells were cultured with the DMEM supplemented with 4.5 g/L glucose (10569010, Gibco), 10% fetal bovine serum (12484010, Gibco) and 1% penicillin/streptomycin (15070063, Gibco). The HEK293T or Hela cells in 6-well plates were transfected with the ZCWPW1-WT-Flag plasmid, ZCWPW1-MUT-Flag plasmid and pCAG plasmid respectively using the jetPRIME Transfection Reagent (101000046, Polyplus) following the manufacturer’s protocol.

Sperm chromatin dispersion (SCD) assay

Sperm chromatin dispersion was evaluated with fresh semen using the SCD assay following the procedure previously described [36] [37]. A minimum of 200 sperm were microscopically evaluated for each semen sample, and sperm containing fragmented DNA displayed very small or no halos. The sperm DNA fragments index (DFI%) is calculated by the number of sperms with DNA fragments / the total number of sperms counted × 100%.

Neutral comet assay

The HEK293T cells were transfected with ZCWPW1-WT-Flag plasmid, ZCWPW1-MUT-Flag plasmid and pCAG plasmid. After 24 h, HEK293T cells were treated with culture medium added with 2 mM hydroxyurea (HY-B0313, MedChemExpress) for 12 h. The slides were coated with 80ul 0.8% normal-gelling agarose first. A total of 1 × 104 cells in 10 μl PBS were mixed with 70 μl 0.8% low-gelling agarose and were layered on the first normal-gelling agarose layer. The slides were immersed in the neutral lysis buffer (2.5 M NaCl, 100 mM Na2EDTA, 10 mM Tris, 1% N-lauroylsarcosine, 1% TritonX-100) for 1 h. For the DNA unwinding procedure, the slides were incubated in fresh neutral electrophoresis buffer (300 mM sodium acetate, 100 mM Tris, PH = 8.3) for 20 min in the dark. The electrophoresis was performed in neutral electrophoresis buffer at 15 V and 80 mA for 30 min. The samples were counterstained with DAPI. The pictures were captured by the fluorescence microscope (AX70, Olympus).