Animals and cells

All mouse studies complied with the United States National Research Council’s Guide for the Care and Use of Laboratory Animals and the Committee on Ethics of Medical Research of the Naval Medical University’s (Approval no.20180308007, Shanghai, China) policies governing the humane and ethical treatment of the experimental subjects. ICR mice (8 weeks old) were obtained from the Naval Medical University’s animal center. All the mice lived under a 12/12-h light/dark cycle environment with a controlled temperature of 22 ± 2 °C. They had free access to adequate food and clean water.

Mouse macrophages (RAW264.7 cells), human lung epithelial cells (BEAS-2B cells) and human lung fibroblasts (HFL-1 cells) were purchased from the National Collection of Authenticated Cell Cultures (Shanghai, China). The culture medium for both RAW264.7 cells and BEAS-2B cells was Dulbecco's modified Eagle medium (DMEM) (HyClone, USA) with 10% fetal bovine serum (FBS) (Gibco, USA) and 100 μg/mL penicillin–streptomycin (HyClone, USA). The hucMSCs were donated to our research group by Origincell Technology Group Company and were cultured in mesenchymal stem cell basal medium (Dakewe, China) containing 5% cell culture supplements (animal serum-free, xenogeneic-free, EliteCell, USA). Alpha minimum essential medium (α-MEM) supplemented with 10% FBS and 100 μg/mL penicillin–streptomycin was used to culture HFL-1 cells. All the cells were grown at 37 °C under 5% CO2 in an incubator.

Extracellular vesicles separation

Cell supernatants were employed to isolate and purify extracellular vesicles. The cells were cultured with animal serum-free, xenogeneic-free cell culture supplements instead of the usual FBS to prevent interference from serum extracellular vesicles. To remove any dead cells and cell debris, the supernatants of the cells were centrifuged at 300 × g for 10 min, 2000 × g for 10 min at 4 °C and then passed through a 0.22 μm filter (Millipore, USA). After centrifugation at 10,000 × g for 30 min at 4 °C, the supernatants were ultracentrifuged at 100,000 × g for 70 min using the ultracentrifuge (Optima XPN-80, SW32 rotor, Beckman Coulter, USA) at 4 °C. The supernatants were removed, and phosphate buffered saline (PBS) (HyClone, USA) was added to the pellets for washing by ultracentrifugation at 100,000 × g for another 70 min at 4 °C. The pellets contained the extracellular vesicles required for the experiments. The final pellets were diluted with 200 μL of PBS and stored at − 80 °C until further use.

Extracellular vesicles characterization

The purified extracellular vesicles were suspended in phosphoric acid buffer. The samples were dropped onto carbon-coated copper grids, adsorbed for 90 s and then stained with uranium acetate solution for 30 s. Transmission electron microscopy was adopted to observe the morphology of the extracellular vesicles. The size distribution of the extracellular vesicles was assessed by nanoparticle tracking analysis. CD9 (1:1000, 13174, CST, USA), CD63 (1:1000, 25682-1-AP, Proteintech, China), CD81 (1:1000, SAB3500454, Sigma, USA) and Cav-1 (1:1000, ab2910, Abcam, UK) are extracellular vesicles-specific biomarkers, and their expression can be visualized by western blotting. Extracellular vesicles labeled with Dil fluorescent dye (Invitrogen, USA) and excess fluorescent dye was removed by ultracentrifugation at 100,000 × g for 1 h then washed twice. The labeled extracellular vesicles were incubated with the cells and the cell fluorescence was observed by confocal microscopy to judge whether the extracellular vesicles could be ingested by the target cells.

Mouse model and hucMSC-EVs administration

The ALI mouse model was established by subcutaneous injection of SM solution. According to previous studies, a subcutaneous injection of SM can cause ALI, and the exposure dose can be accurately controlled in a safe way [14, 15, 22]. In brief, SM diluted to the preset concentration (40 or 30 mg/kg weight used to calculate survival curve or evaluate other experimental indicators) with propylene glycol (Sigma, USA) was subcutaneously injected into the middle of the skin on the back of the mouse. ALI mice were randomly divided into different treatment groups: the hucMSC-EV group, HFL-1-EV group, miR-146a-5p+ hucMSC-EV group, miR-146a-5p− hucMSC-EV group and N-acetyl cysteine (NAC) group. In our study, NAC was a positive control because it has been reported as a leading candidate for the therapy of SM-induced pulmonary toxicity. HFL-1-EVs were used as the negative control. Mice in different types of extracellular vesicles groups were treated with 3 × 108 particle extracellular vesicles suspended in 150 μl of PBS via tail vein injection on the first and third days after SM exposure. Mice in the NAC group were intragastrically administered NAC (200 mg/kg) (Sigma, USA) once a day. At the end of the experiment, mice were injected intraperitoneally with pentobarbital sodium (1% v/v) for anesthesia and then experimental materials were collected. Other mice were euthanized by CO2 asphyxiation. The procedures were approved and performed as indicated by Committee on Ethics of Medical Research, Naval Medical University.

Bronchoalveolar lavage and the lung wet/dry weight ratio

The mice were deeply anesthetized before the thoracic cavity was opened and the trachea was exposed. The trachea was secured with tweezers, and a small gap was cut with scissors. A tube was inserted into the trachea through the gap, through which bronchoalveolar lavage fluid (BALF) was collected by carefully and slowly instilling and withdrawing PBS (0.5 ml) into the lung. After centrifugation (3000 rpm, 10 min), the protein concentration in the BALF was detected by the bicinchoninic acid assay (BCA) (Thermo Scientific, USA) method. To compare lung water contents, mice were sacrificed, and the wet lung tissue weight was obtained by weighing. Then, the tissues were dehydrated for 72 h in a drying oven at 65 °C and weighed again to obtain the dry weight. The ratio of the wet weight to dry weight was the lung wet/dry weight ratio.

Histopathologic examination

After deep anesthesia, the thoracic cavity of mice was opened by median sternotomy. The blood was collected via the left ventricle using a 25 gauge needle. Blood was withdrawn slowly to prevent the heart from collapsing. The lungs were flushed with 10 ml physiological saline and then immediately removed. One of the lungs was used for histopathologic examination and immunohistochemistry. The others were rinsed with saline and used for other experiments. Paraformaldehyde solution (4%, v/v) was used to fix lung tissues. After 24 h, lung tissues were embedded in paraffin. To perform histopathologic examination, the embedded tissue that was sectioned was stained with hematoxylin–eosin (H&E). Tissue sections were investigated, and pictures were taken using a light microscope. Following the recommendations of the American Thoracic Society Official workshop report [23, 24], all tissue sections were evaluated in a blinded manner by two pathologists using five pathological indexes of neutrophils in the alveolar space, neutrophils in the interstitial space, hyaline membranes, proteinaceous debris filling the airspaces and alveolar septal thickening.

Immunohistochemical analysis

Immunohistochemical analysis was used to detect the expression of NF-κB and TRAF6. After deparaffinization and rehydration, the sections were placed in 3% hydrogen peroxide for 15 min to quench endogenous peroxidases. Then, 0.01 M citrate buffer was employed to retrieve the antigens. After blocking with 3% BSA (Sigma, USA) for 30 min, the sections were incubated with the NF-κB (1:400, 6956, CST, USA) or TRAF6 (1:200, 66498-1-Ig, Proteintech, China) primary antibody at 4 °C for more than 12 h and were then stained using diaminobenzidine reagent.

Quantitative real-time PCR

RNAiso Plus reagent (Takara, Japan) was used to extract total RNA from tissues or cell samples. Total RNA (DNA-free) was reverse transcribed with HiScript III qRT SuperMix (Vazyme, China). Quantitative real-time PCR analysis was performed using SYBR green master mix (Vazyme, China). All reactions were performed in triplicate. The relative expression level of target genes was normalized to that of endogenous reference control GAPDH. Specific primers and the transcribed cDNA were used for PCR amplification. TLR4 forward sequence (5′–3′): ATGGCATGGCTTACACCACC, reverse sequence (5′–3′): GAGGCCAATTTTGTCTCCACA; TRAF6 forward sequence (5′–3′): AAAGCGAGAGATTCTTTCCCTG, reverse sequence (5′–3′): ACTGGGGACAATTCACTAGAGC; IRAK1 forward sequence (5′–3′): CCACCCTGGGTTATGTGCC, reverse sequence (5′–3′): GAGGATGTGAACGAGGTCAGC; TNF-α forward sequence (5′–3′): CCCTACCACTCAGATCATCTTCT, reverse sequence (5′–3′): GCTACGACGTGGGCTACAG; IL-1β forward sequence (5′–3′): GCAACTGTTCCTGAACTCAACT, reverse sequence (5′–3′): ATCTTTTGGGGTCCGTCAACT; IL-6 forward sequence (5′–3′): TAGTCCTTCCTACCCCAATTTCC, reverse sequence (5′–3′): TTGGTCCTTAGCCACTCCTTC; IL-10 forward sequence (5′–3′): GCTCTTACTGACTGGCATGAG, reverse sequence (5′–3′): CGCAGCTCTAGGAGCATGTG; miR-146a-5p forward sequence (5′–3′): ACACTCCAGCTGGGTGAGAACTGAATTCCA, reverse sequence (5′–3′): TGGTGTCGTGGAGTCG; U6 forward sequence (5′–3′): CTCGCTTCGGCAGCACA, reverse sequence (5′–3′): AACGCTTCACGAATTTGCGT; and GAPDH forward sequence (5′–3′): AACATCTACAAGCCCAACAACAAGG, reverse sequence (5′–3′): GGTTCTGCAATCACATCTTCAAAGTC.

Western blotting analysis

After washing with precooled PBS, proteins from cells and tissues were lysed and extracted by radio immunoprecipitation assay (RIPA) buffer (Thermo Scientific, USA) mixed with protease inhibitors. The mixtures were centrifuged at 12,000 × g for 15 min to collect the supernatant as the protein solution. BCA protein assay kits were used to determine the protein concentration in the solutions. For the western blotting analysis, the protein solution was boiled at 100 °C for 10 min after evenly mixing with 5 × loading buffer. Denatured protein solutions were prepared as previously described [25]. The membranes were incubated with the primary antibodies against TLR4 (1:200, sc-293072, Santa Cruz, USA), TRAF6 (1:1000, 67591, CST, USA), IRAK1 (1:1000, 4504, CST, USA), NF-κB (1:1000, 4764, CST, USA), phospho-NK-κB (1:1000, 3033, CST, USA), β-Actin (1:1000, AF0003, Beyotime, China) at 4 °C for 12 h, followed by incubation with the secondary antibodies at room temperature for 1 h. Then, an enhanced chemiluminescence system (ECL Western Blotting System) (Millipore, USA) was used to visualize the immunoreactive proteins on the membranes. The protein bands were quantified and analyzed with ImageJ 1.34s software.

Measurement of inflammatory factors with ELISA

Mouse lung tissue was obtained from the mice on the fifth day after SM exposure. The tissue was homogenized and centrifuged at 3500 rpm for 10 min. Cell supernatant samples were collected 24 h after SM exposure. According to the product instructions, the concentrations of cytokines were measured with a multidetection microplate reader using an enzyme-linked immunosorbent assay (ELISA) kit (Westang Bio-tech, China).

siRNA or miRNA mimic and inhibitor transfection of cells

To overexpress or knockdown the miRNA-146a-5p gene, cells were infected with the miRNA-146a-5p mimic or inhibitor (Thermo Scientific, USA) using Lipofectamine RNAiMAX (Invitrogen, USA). RAW264.7 cells were seeded at a density of 2 × 104 cells/cm2 in cell culture plates. After 12 h, cells were transfected with 100 nM siRNA/non-targeting siRNA mixed with Opti-MEM (Invitrogen, USA) and incubated in the cell incubator. After being treated for 36 h, the cells were used for subsequent experiments. HucMSCs were transfected with 100 nM miRNA-146a-5p mimic or inhibitor with Opti-MEM upon reaching 60–70% confluence. After 72 h, the supernatant was collected for extracellular vesicles extraction. The relative expression level of the miRNA-146a-5p gene was compared using quantitative real-time PCR.

Cell viability assay

A Cell Counting Kit-8 (CCK-8) (Dojindo Laboratories, Japan) was used to detect cell viability. CCK-8 solution was evenly mixed with fresh medium at a ratio of 1:10 according to the product instructions and then added to the cell culture plate. After coculture at 37 °C for 1 h, the absorbance of each well in the culture plate at 450 nm was measured using a microplate reader (BioTek, USA). After deducting blank values, the ratio of the experimental group values to the control group values was used to represent the proliferation ability of the cells.

Statistical analysis

The experimental data are represented as the mean ± standard deviation of individuals included in each group and representative of at least three independent experiments. SPSS 21.0 software (IBM, USA) was employed for statistical analysis. When there were only two groups in the experiment, significance was determined with the two-tailed Student’s t test (two groups). If there were more than two groups, significance was determined with one-way ANOVA (multiple groups). Statistical significance was defined as P < 0.05, which is indicated by one (*) asterisk, and two (**) or three (***) asterisks indicate significance of P < 0.01 or P < 0.001, respectively.