Figure 1. Symptomatic hibiscus leaves (left and middle) and a healthy leaf (right) were collected on the island of Oahu, Hawaii.

Figure 2. Phylogenetic analysis based on the genomic nucleotide sequences of members of the genera Alphacarmovirus, Betacarmovirus, and Gammacarmovirus was performed using the Maximum Likelihood method and MEGA X software with 1000 bootstrap repetitions. The red dot indicates the new virus hibiscus betacarmovirus that we found in this study.

Figure 2. Phylogenetic analysis based on the genomic nucleotide sequences of members of the genera Alphacarmovirus, Betacarmovirus, and Gammacarmovirus was performed using the Maximum Likelihood method and MEGA X software with 1000 bootstrap repetitions. The red dot indicates the new virus hibiscus betacarmovirus that we found in this study.

Figure 3. Phylogenetic analysis based on the genomic nucleotide sequences of members of the genus Soymovirus was performed using the maximum likelihood method and MEGA X software with 1000 bootstrap repetitions. The red dot indicates the new virus hibiscus soymovirus that we found in this study.

Table 1. Primers used in the present study for RACE experiments and detection of hibiscus betacarmovirus (HBCV) and hibiscus soymovirus (HSV) using RT-PCR assays.

Table 1. Primers used in the present study for RACE experiments and detection of hibiscus betacarmovirus (HBCV) and hibiscus soymovirus (HSV) using RT-PCR assays.

PurposeIDSequence-5′ to 3′LengthHBCV detectionBCVF1CCTGAGGTTTGAGCACAGCA659 bpBCVR1GACCAAGGCTCCTCTTTGCAHSV detectionSVF1AGGAAGATGGTCGTTTTGGG429 bpSVR1ACTGGACTGCTGGTTGTATG5′-RACEHBCV _GSP1GATTACGCCAAGCTTTGGGTTATGCCCAAGACCAC-3′-RACEHBCV _GSP2GATTACGCCAAGCTTAAAACCGGTGTTATTGCCGC-

Table 2. Comparison of amino acid sequences of RNA-dependent RNA polymerase (RdRp) and coat protein (CP) from different hibiscus chlorotic ringspot virus isolates with those of hibiscus betacarmovirus.

Table 2. Comparison of amino acid sequences of RNA-dependent RNA polymerase (RdRp) and coat protein (CP) from different hibiscus chlorotic ringspot virus isolates with those of hibiscus betacarmovirus.

IsolateNucleotideAmino AcidRdRpCPIsraelKC876666AGN7038053.3%32.6%TaiwanDQ392986ABD4870852.9%33.1%MalaysiaMN080500QDJ9588553.3%33.4%SingaporeX86448CAB8176753.0%34.0%HawaiiMT512573QWX2161753.0%33.7%ChinaKY933060AVK9411253.1%34.0%