Figure 1. Schematic flowchart of the experimental design.

Figure 1. Schematic flowchart of the experimental design.

Figure 2. Astragaloside IV reduces acute renal injury induced by ischemia-reperfusion. (A,B) The level of serum creatinine and urea nitrogen 24 h after ischemia-reperfusion. (C) Western blotting shows the expression of kidney injury molecule-1 (Kim-1) in kidney tissue 24 h after ischemia-reperfusion. (D) Representative H&E staining of renal tissue sections 24 h after ischemia-reperfusion (magnification ×200, ×400); blue arrows indicate tubular epithelial cell necrosis with nuclear dissolution or fragmentation and calcification. Yellow arrows indicate eosinophils infiltration. n = 6 in each group, * p < 0.05, ** p < 0.01.

Figure 2. Astragaloside IV reduces acute renal injury induced by ischemia-reperfusion. (A,B) The level of serum creatinine and urea nitrogen 24 h after ischemia-reperfusion. (C) Western blotting shows the expression of kidney injury molecule-1 (Kim-1) in kidney tissue 24 h after ischemia-reperfusion. (D) Representative H&E staining of renal tissue sections 24 h after ischemia-reperfusion (magnification ×200, ×400); blue arrows indicate tubular epithelial cell necrosis with nuclear dissolution or fragmentation and calcification. Yellow arrows indicate eosinophils infiltration. n = 6 in each group, * p < 0.05, ** p < 0.01.

Figure 3. AS-IV inhibits macrophage infiltration and promotes M1 to M2 phenotypic switching 24 h after I/R. (A) Immunohistochemistry staining of F4/80 and quantification score of CTL, I/R, I/R+AS-IV groups (magnification ×400). The brown areas represent positive expression of F4/80. (B) Serum IL-10, TNF-α, and IL-6 levels 24 h after ischemia-reperfusion determined by ELISA. (C) Relative mRNA levels of IL-6, TNF-α, Arginase I, and IL-10 in kidney tissues. n = 6 in each group, * p < 0.05, ** p < 0.01.

Figure 3. AS-IV inhibits macrophage infiltration and promotes M1 to M2 phenotypic switching 24 h after I/R. (A) Immunohistochemistry staining of F4/80 and quantification score of CTL, I/R, I/R+AS-IV groups (magnification ×400). The brown areas represent positive expression of F4/80. (B) Serum IL-10, TNF-α, and IL-6 levels 24 h after ischemia-reperfusion determined by ELISA. (C) Relative mRNA levels of IL-6, TNF-α, Arginase I, and IL-10 in kidney tissues. n = 6 in each group, * p < 0.05, ** p < 0.01.

Figure 4. AS-IV promotes macrophage polarization toward M2 phenotype through suppressing NF-κB p65/Hif-1α pathway in vitro. (A) Levels of IL-6 and IL-10 in M1 cellular supernatants was analyzed by ELISA. (B) Western blot results of Arginase I, p65, and Hif-1α in RAW 264.7 under normoxia, hypoxia, or hypoxia with AS-IV; n = 3 in each group, NS, no significance, * p < 0.05, ** p < 0.01.

Figure 4. AS-IV promotes macrophage polarization toward M2 phenotype through suppressing NF-κB p65/Hif-1α pathway in vitro. (A) Levels of IL-6 and IL-10 in M1 cellular supernatants was analyzed by ELISA. (B) Western blot results of Arginase I, p65, and Hif-1α in RAW 264.7 under normoxia, hypoxia, or hypoxia with AS-IV; n = 3 in each group, NS, no significance, * p < 0.05, ** p < 0.01.

Figure 5. AS-IV regulated Hif-1α is mediated by p65 under hypoxia. (A) Western blotting analysis of p65 and Hif-1α after transfection of p65 siRNA or si-nc. (B) Western blotting analysis of p65 and Hif-1α after transfection of Hif-1α siRNA or si-nc. (C) Western blotting analysis of p65 and Hif-1 after transfection of p65 siRNA with or without AS-IV; n = 3 in each group, NS, no significance, * p < 0.05, ** p< 0.01.

Figure 5. AS-IV regulated Hif-1α is mediated by p65 under hypoxia. (A) Western blotting analysis of p65 and Hif-1α after transfection of p65 siRNA or si-nc. (B) Western blotting analysis of p65 and Hif-1α after transfection of Hif-1α siRNA or si-nc. (C) Western blotting analysis of p65 and Hif-1 after transfection of p65 siRNA with or without AS-IV; n = 3 in each group, NS, no significance, * p < 0.05, ** p< 0.01.

Figure 6. AS-IV attenuates kidney fibrosis 28 days after I/R. (A) Representative Masson staining (blue area) of renal tissue sections (magnification ×200). (B) Immunohistochemistry staining of α-SMA. The brown areas represent positive expression of α-SMA (magnification ×200). (C) Western blot results of fibrotic proteins (Fibronectin, Collagen I, and α-SMA) in renal tissues 28 days after I/R. n = 6 in each group, NS, no significance, * p < 0.05, ** p < 0.01.

Figure 6. AS-IV attenuates kidney fibrosis 28 days after I/R. (A) Representative Masson staining (blue area) of renal tissue sections (magnification ×200). (B) Immunohistochemistry staining of α-SMA. The brown areas represent positive expression of α-SMA (magnification ×200). (C) Western blot results of fibrotic proteins (Fibronectin, Collagen I, and α-SMA) in renal tissues 28 days after I/R. n = 6 in each group, NS, no significance, * p < 0.05, ** p < 0.01.

Figure 7. AS-IV reduces infiltrated M2 macrophages in the renal interstitium 28 days after I/R. Representative immunofluorescent co-staining images of CD206 and α-SMA in the renal interstitium (magnification ×200). Green corresponds to CD206, red corresponds to α-SMA, and blue corresponds to nuclear staining (DAPI).

Figure 7. AS-IV reduces infiltrated M2 macrophages in the renal interstitium 28 days after I/R. Representative immunofluorescent co-staining images of CD206 and α-SMA in the renal interstitium (magnification ×200). Green corresponds to CD206, red corresponds to α-SMA, and blue corresponds to nuclear staining (DAPI).

Figure 8. AS-IV regulates M2 macrophages through Hif-1α/Smad7 signaling pathway. (A) Western blot results of Hif-1α and Samd7 in M2 macrophages under normoxia, hypoxia, hypoxia with AS-IV. (B) Western blotting results of Smad7 after transfection of Hif-1α siRNA or si-nc in M2 macrophages under hypoxic conditions. (C) Western blotting results of Hif-1α after transfection of Smad7 siRNA or si-nc in M2 macrophages under hypoxic conditions. (D) Western blot results of Hif-1α and Samd7 in M2 macrophages transfected of Hif-1α siRNA under hypoxic conditions with or without AS-IV. n = 3 in each group. NS, no significance, * p < 0.05, ** p < 0.01.

Figure 8. AS-IV regulates M2 macrophages through Hif-1α/Smad7 signaling pathway. (A) Western blot results of Hif-1α and Samd7 in M2 macrophages under normoxia, hypoxia, hypoxia with AS-IV. (B) Western blotting results of Smad7 after transfection of Hif-1α siRNA or si-nc in M2 macrophages under hypoxic conditions. (C) Western blotting results of Hif-1α after transfection of Smad7 siRNA or si-nc in M2 macrophages under hypoxic conditions. (D) Western blot results of Hif-1α and Samd7 in M2 macrophages transfected of Hif-1α siRNA under hypoxic conditions with or without AS-IV. n = 3 in each group. NS, no significance, * p < 0.05, ** p < 0.01.

Table 1. Primer sequences for quantitative real-time polymerase chain reaction.

Table 1. Primer sequences for quantitative real-time polymerase chain reaction.

GeneSequences (5′-3′)Length (bp)TNF-αForwardaccggcatggatctcaaagac129 bp Reversegtccgggtgaggagcacgtagt IL-6Forward cccccaacttccaatgctctcct134 bp Reverse aggtcttgccgagtagacctc Arg1Forwardaaagcctggtctgctggaaaa122 bp Reverse acagacccgtgggttcttcac IL-10Forward ccaagcccttatcggaaatga111 bp Reverse ttttcacagcgggagaaatcg β-actinForwardgccctgaggcctcttttccag51 bp Reversetgccacaggacttccataccc