Conceptualization, E.-J.C. and X.B.; methodology, E.-J.C., W.W., K.Z., X.Y., J.D., D.I., D.L.B. and K.S.T.; software, X.Y. and S.Z.; formal analysis, E.-J.C. and X.Y.; investigation, X.B., R.P.G. and S.Z.; writing—original draft preparation, E.-J.C.; writing—review and editing, X.B.; All authors have read and agreed to the published version of the manuscript.

Figure 1. Changes in the expression of tRF5s in NPS samples by RSV. qRT-PCR was performed to detect (A) tRF5-GluCTC, (B) tRF5-GlyCCC, and (C) tRF5-CysGCA in the NPS from RSV and control (CN) patients. An unpaired two-tailed Mann-Whitney U test was used to compare two independent groups. The three asterisks represent a p-value of 0.001. For correlation analyses for tRF5-GluCTC (D), tRF5-GlyCCC (E), or tRF5-CysGCA (F) with NPS viral genome copies, we performed Spearman’s rank correlation test. Spearman’s rank correlation coefficient (RS) was used to determine correlations. A p-value of less than 0.05 was considered significant.

Figure 1. Changes in the expression of tRF5s in NPS samples by RSV. qRT-PCR was performed to detect (A) tRF5-GluCTC, (B) tRF5-GlyCCC, and (C) tRF5-CysGCA in the NPS from RSV and control (CN) patients. An unpaired two-tailed Mann-Whitney U test was used to compare two independent groups. The three asterisks represent a p-value of 0.001. For correlation analyses for tRF5-GluCTC (D), tRF5-GlyCCC (E), or tRF5-CysGCA (F) with NPS viral genome copies, we performed Spearman’s rank correlation test. Spearman’s rank correlation coefficient (RS) was used to determine correlations. A p-value of less than 0.05 was considered significant.

Figure 2. The schematic summaries on tRNA-GluCTC preparation. (A) Sequencing information on tRF5-GluCTC and its parent tRNA, the antisense probe used to detect tRNA by Northern blot, and biotinylated antisense oligo to pull down tRNA-GluCTC. (B) The workflow to purify tRNA-GluCTC. (C) The input and purified tRNA-GluCTC from mock- and RSV-infected cells. Left panel: SYBRTM Green II RNA staining of total RNAs for mock- and RSV-infected cells (left two lanes) and enriched tRNAs (right two lanes). Middle panel: input RNAs and enriched tRNAs were detected by antisense oligo against tRNA-GluCTC. Right panel: input RNAs and enriched tRNAs were detected by antisense against tRNA-GlyGCC.

Figure 2. The schematic summaries on tRNA-GluCTC preparation. (A) Sequencing information on tRF5-GluCTC and its parent tRNA, the antisense probe used to detect tRNA by Northern blot, and biotinylated antisense oligo to pull down tRNA-GluCTC. (B) The workflow to purify tRNA-GluCTC. (C) The input and purified tRNA-GluCTC from mock- and RSV-infected cells. Left panel: SYBRTM Green II RNA staining of total RNAs for mock- and RSV-infected cells (left two lanes) and enriched tRNAs (right two lanes). Middle panel: input RNAs and enriched tRNAs were detected by antisense oligo against tRNA-GluCTC. Right panel: input RNAs and enriched tRNAs were detected by antisense against tRNA-GlyGCC.

Figure 3. Identified tRNA modification changes by RSV. (A) Sequencing workflow. More detailed information can be found in Materials and Methods. (B,C) Stoichiometric changes of m1A at position 57 methylated nucleotides by RSV infection. The percentage of m1A at position 57 was reduced from 51% in the mock-infected cells (B) to 11% in RSV-infected cells (C). (D) The putative change of 1 Da on the pseudouritidine D by RSV.

Figure 3. Identified tRNA modification changes by RSV. (A) Sequencing workflow. More detailed information can be found in Materials and Methods. (B,C) Stoichiometric changes of m1A at position 57 methylated nucleotides by RSV infection. The percentage of m1A at position 57 was reduced from 51% in the mock-infected cells (B) to 11% in RSV-infected cells (C). (D) The putative change of 1 Da on the pseudouritidine D by RSV.

Figure 4. The impact of ALKBH1 on the RSV infection. (A) ALKBH1 gene knockdown prevents the induction of tRF5-GluCTC by RSV. The input of total RNAs in mock- and RSV-infected cells were checked by EB staining and induced tRF5-GluCTC was determined by Northern blot. (B,C) ALKBH1 gene knockdown decreased the expression of RSV proteins. The ALKBH1 gene knockdown was confirmed by Western blot using an anti-ALKBH1 antibody. The membrane was stripped and reprobed for RSV proteins and β-actin (B). Densitometric analysis of the band intensity of ALKBH1 was performed using the histogram function of Adobe Photoshop. Results are shown after corrections to β-actin. Results are representative of three independent experiments (C). (D) The impact of ALKBH1 on RSV virus titration was also determined. The double asterisk represents p values of 0.01. Data are shown as means ± SE. (E) The nuclear and cytosolic expression of ALKBH1 along RSV infection. The membranes were stripped and reprobed for lamin B as a loading control for nuclear fraction, while β-actin was used as a loading control for cytosol fraction.

Figure 4. The impact of ALKBH1 on the RSV infection. (A) ALKBH1 gene knockdown prevents the induction of tRF5-GluCTC by RSV. The input of total RNAs in mock- and RSV-infected cells were checked by EB staining and induced tRF5-GluCTC was determined by Northern blot. (B,C) ALKBH1 gene knockdown decreased the expression of RSV proteins. The ALKBH1 gene knockdown was confirmed by Western blot using an anti-ALKBH1 antibody. The membrane was stripped and reprobed for RSV proteins and β-actin (B). Densitometric analysis of the band intensity of ALKBH1 was performed using the histogram function of Adobe Photoshop. Results are shown after corrections to β-actin. Results are representative of three independent experiments (C). (D) The impact of ALKBH1 on RSV virus titration was also determined. The double asterisk represents p values of 0.01. Data are shown as means ± SE. (E) The nuclear and cytosolic expression of ALKBH1 along RSV infection. The membranes were stripped and reprobed for lamin B as a loading control for nuclear fraction, while β-actin was used as a loading control for cytosol fraction.

Table 1. Patient gender, age, and race information.

Table 1. Patient gender, age, and race information.

Control (CN)RSV PatientNo. of patients89Gender (Male:Female)5:35:4Mean age (months (range))7.68 (0.75~14)7.88 (1.25~16)Race (African American:Caucasian:Asian)2:5:13:6:0

Table 2. Primer information to detect tRF5s using qRT-PCR.

Table 2. Primer information to detect tRF5s using qRT-PCR.

tRF5–GlyCCCSequenceGCAUUGGUGGUUCAGUGGUAGAAUUCUCGCCForward primerGCATGGGTGGTTCAGTGReverse primerCGTCGGACTGTAGAACTCTCAAAGCtRF5–GluCTCSequenceUCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGCUForward primerTCCCTGGTGGTCTAGTGReverse primerCGTCGGACTGTAGAACTCTCAAAGCtRF5–CysGCASequenceGGGUAUAGCUCAGUGGUAGAGCAUUUGACUGCForward primerAGTGGTAGAGCATTTGACTGCReverse primerCGTCGGACTGTAGAACTCTCAAAGC