Conceptualization, Y.X.; Data curation, Y.L. (Yutian Liu), M.W., G.D. and Y.L. (Yingchao Li); Investigation, D.L., Q.Z., Y.L. (Yutian Liu), L.Z. and L.H.; Methodology, Q.Z.; Software, M.W.; Supervision, Z.W. and Y.X.; Validation, L.Z., X.C. and G.D.; Writing—original draft, D.L., Q.Z., Y.L. (Yingchao Li) and Y.X.; Writing—review and editing, Y.H., S.L., Z.W. and Y.X. All authors have read and agreed to the published version of the manuscript.

Figure 1. Jameson–Wolf protein antigenicity profile for p30, p54 and p72. The X–axis values are amino acid residues for each protein; the Y–axis represents the antigenic index (Jameson and Wolf, 1988). Positions of each truncated recombinant proteins are shown in boxes. p30 1–66aa, 78–132aa and 134–174aa contain amino acids of p30 from 1 to 66, 78 to 132 and 134 to 174, respectively. p54 54–124aa contains amino acids of p54 from 54 to 124. p72 12–89aa, p72 139–324aa, p72 445–524aa and p72 552–647aa contain amino acids of p72 from 12 to 89, 139 to 324, 445 to 524 and 552 to 647, respectively.

Figure 1. Jameson–Wolf protein antigenicity profile for p30, p54 and p72. The X–axis values are amino acid residues for each protein; the Y–axis represents the antigenic index (Jameson and Wolf, 1988). Positions of each truncated recombinant proteins are shown in boxes. p30 1–66aa, 78–132aa and 134–174aa contain amino acids of p30 from 1 to 66, 78 to 132 and 134 to 174, respectively. p54 54–124aa contains amino acids of p54 from 54 to 124. p72 12–89aa, p72 139–324aa, p72 445–524aa and p72 552–647aa contain amino acids of p72 from 12 to 89, 139 to 324, 445 to 524 and 552 to 647, respectively.

Figure 2. Identification of His–fused p30, p54 and p72 proteins. (A) Identification of purification of His–fused p30, p54 and p72 proteins by SDS–PAGE. All the samples were electrophoresed on SDS–PAGE and visualized by coomassie brilliant blue G250 staining. Here, 1, 6, 11 represent whole cell lysates without IPTG induction, 2, 7, 12 represent whole cell lysates with IPTG induction, 3, 8, 13 represent the expression of His–fused protein from the supernatant, 4, 9, 14 represent the expression of His–fused protein from the inclusion bodies and 5, 10, 15 represent purified proteins. (B) Western blot identification of the His–fused p30, p54 and p72 proteins. The purified His–fused p30, p54 and p72 proteins were separated by SDS–PAGE and transferred to PVDF membrane. The target proteins were probed with anti–His antibody. *: the target bands.

Figure 2. Identification of His–fused p30, p54 and p72 proteins. (A) Identification of purification of His–fused p30, p54 and p72 proteins by SDS–PAGE. All the samples were electrophoresed on SDS–PAGE and visualized by coomassie brilliant blue G250 staining. Here, 1, 6, 11 represent whole cell lysates without IPTG induction, 2, 7, 12 represent whole cell lysates with IPTG induction, 3, 8, 13 represent the expression of His–fused protein from the supernatant, 4, 9, 14 represent the expression of His–fused protein from the inclusion bodies and 5, 10, 15 represent purified proteins. (B) Western blot identification of the His–fused p30, p54 and p72 proteins. The purified His–fused p30, p54 and p72 proteins were separated by SDS–PAGE and transferred to PVDF membrane. The target proteins were probed with anti–His antibody. *: the target bands.

Figure 3. Confirmation of mouse and rabbit polyclonal antibodies. (A) The titer of the polyclonal antibodies produced in mouse and rabbit. X–axis was the sera with different dilution ratios. Y–axis on the left was OD values generated by p30, p54, p72–coated iELISA for the detection of antibody responses against p30, p54, p72, respectively. Each point on each dilution represents the mean OD values obtained from 3 mice and 3 rabbit serum samples. Results were performed as the means ± SD and analyzed with Graph–PadPrism8 software (San Diego, CA, USA). Western blot was used to confirm the specificity of the mouse (B) or rabbit (C) polyclonal antibodies. Eukaryotic expression vector containing p30, p54 and p72 genes with GFP tag or pEGFP–C1 vector were transfected into 293T cells. The cell lysates were immunoblotted with mouse or rabbit polyclonal anti–p30, p54 or p72 antibody, respectively.

Figure 3. Confirmation of mouse and rabbit polyclonal antibodies. (A) The titer of the polyclonal antibodies produced in mouse and rabbit. X–axis was the sera with different dilution ratios. Y–axis on the left was OD values generated by p30, p54, p72–coated iELISA for the detection of antibody responses against p30, p54, p72, respectively. Each point on each dilution represents the mean OD values obtained from 3 mice and 3 rabbit serum samples. Results were performed as the means ± SD and analyzed with Graph–PadPrism8 software (San Diego, CA, USA). Western blot was used to confirm the specificity of the mouse (B) or rabbit (C) polyclonal antibodies. Eukaryotic expression vector containing p30, p54 and p72 genes with GFP tag or pEGFP–C1 vector were transfected into 293T cells. The cell lysates were immunoblotted with mouse or rabbit polyclonal anti–p30, p54 or p72 antibody, respectively.

Figure 4. Identification of truncated proteins. (A) Identification the expression of truncated proteins by SDS–PAGE. The whole cellular proteins with induction were electrophoresed on 10–15% SDS–PAGE and visualized by coomassie brilliant blue G250 staining. The predicted molecular weights with a GST tag of p30 1–66aa, p30 78–132aa, p30 134–174aa, p72 12–89aa and p72 445–524aa were 33.41, 32.35, 30.82, 34.75 and 35.34 KDa, respectively. The predicted molecular weights with an His tag of p54 54–124aa, p72 139–324aa and p72 552–647aa were 10.4, 21.21 and 11.54 KDa, respectively. (B) Identification the expression of truncated proteins by Western blot. The purified proteins of p30 1–66aa, p30 78–132aa, p30 134–174aa, p72 12–89aa and p72 445–524aa were separated and probed with anti–GST monoclonal antibody. The purified proteins p54 54–124aa, p72 139–324aa and p72 552–647aa were separated and probed with anti–His monoclonal antibody. *: the target bands.

Figure 4. Identification of truncated proteins. (A) Identification the expression of truncated proteins by SDS–PAGE. The whole cellular proteins with induction were electrophoresed on 10–15% SDS–PAGE and visualized by coomassie brilliant blue G250 staining. The predicted molecular weights with a GST tag of p30 1–66aa, p30 78–132aa, p30 134–174aa, p72 12–89aa and p72 445–524aa were 33.41, 32.35, 30.82, 34.75 and 35.34 KDa, respectively. The predicted molecular weights with an His tag of p54 54–124aa, p72 139–324aa and p72 552–647aa were 10.4, 21.21 and 11.54 KDa, respectively. (B) Identification the expression of truncated proteins by Western blot. The purified proteins of p30 1–66aa, p30 78–132aa, p30 134–174aa, p72 12–89aa and p72 445–524aa were separated and probed with anti–GST monoclonal antibody. The purified proteins p54 54–124aa, p72 139–324aa and p72 552–647aa were separated and probed with anti–His monoclonal antibody. *: the target bands.

Figure 5. Screening the antigenic dominants of p30, p54 and p72 proteins. Screening the dominant antigenic domains. All the truncated proteins were separated by SDS–PAGE and transferred to PVDF membrane. The target proteins were probed with ASFV positive pig serum (A), mouse anti–p30, –p54 and –p72 polyclonal antibody (B) and rabbit anti–p30, –p54 and –p72 polyclonal antibody (C).

Figure 5. Screening the antigenic dominants of p30, p54 and p72 proteins. Screening the dominant antigenic domains. All the truncated proteins were separated by SDS–PAGE and transferred to PVDF membrane. The target proteins were probed with ASFV positive pig serum (A), mouse anti–p30, –p54 and –p72 polyclonal antibody (B) and rabbit anti–p30, –p54 and –p72 polyclonal antibody (C).

Figure 6. Identification of His–p30–p54–p72 protein. The cellular or purified proteins were electrophoresed on 10% SDS–PAGE and visualized by coomassie brilliant blue G250 staining (A) or were transferred to PVDF membrane probed with anti–His monoclonal antibody (B). (C) Identification of the His–p30–p54–p72 protein by rabbit anti–p30, –p54 and –p72 polyclonal antibody. *: the target bands.

Figure 6. Identification of His–p30–p54–p72 protein. The cellular or purified proteins were electrophoresed on 10% SDS–PAGE and visualized by coomassie brilliant blue G250 staining (A) or were transferred to PVDF membrane probed with anti–His monoclonal antibody (B). (C) Identification of the His–p30–p54–p72 protein by rabbit anti–p30, –p54 and –p72 polyclonal antibody. *: the target bands.

Table 1. Primers used for constructs.

Table 1. Primers used for constructs.

ConstructsPrimer (5′–3′)VectorInsoluble/SolublepET–28aF: CAAGCTTGCGGCCGCACT R: TCGACGGAGCTCGAATTCG EGFP–C1F: GTCGACGGTACCGCGGGC R: TGCAGAATTCGAAGCTTGAGC pGEX–6P–1F: GTCGACTCGAGCGGCCGCA R: CCCGGGAATTCCGGGGATC pEGFP–C1–p30F: CTCAAGCTTCGAATTCTGCAATGGATTTTATTTTAAATATATCCATpEGFP–C1Eukaryotic expressionR: GGGCCCGCGGTACCGTCGACTTATTTTTTTTTTAAAAGTTTAApEGFP–C1–p54F: CTCAAGCTTCGAATTCTGCAATGGATTCTGAATTTTTTCAApEGFP–C1Eukaryotic expressionR: GGGCCCGCGGTACCGTCGACTTACAAGGAGTTTTCTAGGTCTpEGFP–C1–p72F: CTCAAGCTTCGAATTCTGCAATGGCATCAGGAGGAGCTTpEGFP–C1Eukaryotic expressionR: GGGCCCGCGGTACCGTCGACTTAGGTACTGTAACGCAGCACApGEX–6P–1–p30 (1–66aa)F: GATCCCCGGAATTCCCGGGATGGACCTGCGTAGCAGCAGpGEX–6P–1InsolubleR: TGCGGCCGCTCGAGTCGACTTCCTCTTGCGCCTGGTGCpGEX–6P–1–p30 (78–132aa)F: GATCCCCGGAATTCCCGGGGAGACCGAAAGCAGCGCGAGpGEX–6P–1InsolubleR: TGCGGCCGCTCGAGTCGACGATGTGTTGAACGGTTTTCTGCpGEX–6P–1–p30 (134–174aa)F: GATCCCCGGAATTCCCGGGCAGTATGGCAAGGCGCCGGpGEX–6P–1InsolubleR: TGCGGCCGCTCGAGTCGACCAGTTTGATAACCATCApET–28a–p54 (54–124aa)F: CCGAATTCGAGCTCCGTCGACGTCCGGCGACCAACCGTCpET–28aSolubleR: CGAGTGCGGCCGCAAGCTTGATAGGTGTTACGTTGACGCpGEX–6P–1–p72 (12–89aa)F: GATCCCCGGAATTCCCGGGGATGGGAAGGCCGACAAGpGEX–6P–1InsolubleR: TGCGGCCGCTCGAGTCGACAAGCTTGTTTCCCAAGGTGpET–28a–p72 (139–324aa)F: CCGAATTCGAGCTCCGTCGACGCAACGGATATGACTGGGpET–28aInsolubleR: CGAGTGCGGCCGCAAGCTTGCTGATAGTATTTAGGGGTTTGpGEX–6P–1–p72 (445–524aa)F: GATCCCCGGAATTCCCGGGCACACCAACAATAACCACCACpGEX–6P–1InsolubleR: TGCGGCCGCTCGAGTCGACATCCGATATAGATGAACATGpET–28a–p72 (552–647aa)F: CCGAATTCGAGCTCCGTCGAAAGTTTCCATCAAAGTTCTGpET–28aInsolubleR: CGAGTGCGGCCGCAAGCTGAAGTTTCCATCAAAGTTC TGLinker–p30 (78–132aa)F: CCGAATTCGAGCTCCGTCGAGAGACCGAAAGCAGCGCG R: GATCCTCCACCTCCTGATCCACCTCCACCGATGTGTTGAACGGTTTLinker–p30 (134–174aa)F: GATCAGGAGGTGGAGGATCACAGTATGGCAAGGCGCCG R: AGAACCACCGCCACCCGAGCCGCCACCGCCCAGTTTGATAACCALinker–p54 (54–124aa)F: GGCGGTGGCGGCTCGGGTGGCGGTGGTTCTCGTCCGGCGACCAA R: CGATCCGCCTCCACCGGAACCTCCGCCTCCATAGGTGTTACGTTGALinker–p72 (12–89aa)F: GGAGGCGGAGGTTCCGGTGGAGGCGGATCGGATGGGAAGGCCG R: GGAGCCTCCGCCGCCAGATCCGCCTCCCCCAAGCTTGTTTCCCAALinker––p72 (139––324aa)F: CTGGCGGCGGAGGCTCCCGCAACGGATATGACTGGGA R: AGAACCACCGCCACCCGAGCCGCCACCGCCCTGATAGTATTTAGLinker––p72 (445––524aa)F: CGGGTGGCGGTGGTTCTCACACCAACAATAACCACCAC R: CGAGTGCGGCCGCAAGCTTGATCCGATATAGATGAACATGCGT

Table 2. Clinical samples from detected by different ELISAs.

Table 2. Clinical samples from detected by different ELISAs.

Target Proteinsa/b/p30–54–72 (+)a/b (+)/p30–54–72(+)a/b (−)/p30–54–72 (−)a or b (−)/p30–54–72(+)p30 a140 (72.9%)137 (97.9%)40 (76.9%)9 (4.7%)p72 b121 (63%)121 (100%)43 (60.6%)28 (14.6%)His–p30–p54–p72149 (77.6%)///