Figure 1. Stemness characterization of the YM1- and KYSE30-derived spheres. (A) shows the adherent form of the original cells and the tumorspheres in passage 3. (B) shows increased gene expression of the pluripotency regulators (SOX2, OCT4A, and Nanog) in spheres of compared to the adherent cells, measured by qRT-PCR. * p-value < 0.05.

Figure 1. Stemness characterization of the YM1- and KYSE30-derived spheres. (A) shows the adherent form of the original cells and the tumorspheres in passage 3. (B) shows increased gene expression of the pluripotency regulators (SOX2, OCT4A, and Nanog) in spheres of compared to the adherent cells, measured by qRT-PCR. * p-value < 0.05.

Figure 2. The flowcytometry analysis of CD44 cancer stem cell marker in adherent and tumorspheres. The percentages of CD44 positive cells are shown in the graphs. The unstained cell was used for background subtraction.

Figure 2. The flowcytometry analysis of CD44 cancer stem cell marker in adherent and tumorspheres. The percentages of CD44 positive cells are shown in the graphs. The unstained cell was used for background subtraction.

Figure 3. Overexpression of SOX2OT in tumorspheres of esophageal cancer cells (YM1 and KYSE30) * p-value < 0.05. bars represent mean ± SE.

Figure 3. Overexpression of SOX2OT in tumorspheres of esophageal cancer cells (YM1 and KYSE30) * p-value < 0.05. bars represent mean ± SE.

Figure 4. SOX2OT knockdown in ESCC cells. Fluorescence imaging of the FITC-scrambled siRNA transfected ESCCs. The transfected siRNA is shown in green (A) and nuclear is stained with dapi in blue (B) color. The merged image is shown in (C). The quantitative gene expression assessment demonstrated significant downregulation of the SOX2OT in siRNA-transfected YM1-S and KYSE30-S tumorspheres in comparison to the control scrambled siRNA-transfected tumorspheres (D). YM1-S: YM1 sphere, KYSE30-S: KYSE30 sphere, * p-value = 0.017 and # p-value = 0.05. bars represent mean ± SE.

Figure 4. SOX2OT knockdown in ESCC cells. Fluorescence imaging of the FITC-scrambled siRNA transfected ESCCs. The transfected siRNA is shown in green (A) and nuclear is stained with dapi in blue (B) color. The merged image is shown in (C). The quantitative gene expression assessment demonstrated significant downregulation of the SOX2OT in siRNA-transfected YM1-S and KYSE30-S tumorspheres in comparison to the control scrambled siRNA-transfected tumorspheres (D). YM1-S: YM1 sphere, KYSE30-S: KYSE30 sphere, * p-value = 0.017 and # p-value = 0.05. bars represent mean ± SE.

Figure 5. Downregulation of SOX2OT in YM1 and KYSE30 tumorspheres. (A) shows the phenotype of the tumorspheres of each cell line after SOX2OT siRNA or control non-target siRNA transfection. (B) shows the decreased expression of pluripotency genes in SOX2OT knocked down tumorspheres. YM1: * p-value = 0.05 (SOX2, OCT4A) and KYSE30: p-value = 0.064 SOX2, p-value = 0.083 OCT4A and bars represent mean ± SE.

Figure 5. Downregulation of SOX2OT in YM1 and KYSE30 tumorspheres. (A) shows the phenotype of the tumorspheres of each cell line after SOX2OT siRNA or control non-target siRNA transfection. (B) shows the decreased expression of pluripotency genes in SOX2OT knocked down tumorspheres. YM1: * p-value = 0.05 (SOX2, OCT4A) and KYSE30: p-value = 0.064 SOX2, p-value = 0.083 OCT4A and bars represent mean ± SE.

Figure 6. The sphere formation capability of ESCC tumorspheres after SOX2OT knockdown. The comparison was carried out between SOX2OT knocked down (SOX2OT-si) and control siRNA transfected (Con-si) tumorspheres of each cell line. Both sphere diameter and count were measured in at least five fields with light microscopy for 24 and 48 h after transfection. * p-value ≤ 0.05 and ** p-value < 0.003 and *** p-value = 0.0001 vs. control.

Figure 6. The sphere formation capability of ESCC tumorspheres after SOX2OT knockdown. The comparison was carried out between SOX2OT knocked down (SOX2OT-si) and control siRNA transfected (Con-si) tumorspheres of each cell line. Both sphere diameter and count were measured in at least five fields with light microscopy for 24 and 48 h after transfection. * p-value ≤ 0.05 and ** p-value < 0.003 and *** p-value = 0.0001 vs. control.

Figure 7. SOX2OT knockdown decreases the viability alone or in combination with docetaxel. The cytotoxicity of SOX2OT knockdown has been shown for both cell line adherents and spheres (A). The chemotoxicity of docetaxel (IC50) alone or in combination with SOX2OT-siRNA has been shown for both cell lines adherent and sphere cells (B). Doc: docetaxel. The two-way ANOVA test with Bonferroni comparison has been calculated by graph pad. * p-value < 0.01 and ** p-value < 0.001. Each Bar represents mean ± SE.

Figure 7. SOX2OT knockdown decreases the viability alone or in combination with docetaxel. The cytotoxicity of SOX2OT knockdown has been shown for both cell line adherents and spheres (A). The chemotoxicity of docetaxel (IC50) alone or in combination with SOX2OT-siRNA has been shown for both cell lines adherent and sphere cells (B). Doc: docetaxel. The two-way ANOVA test with Bonferroni comparison has been calculated by graph pad. * p-value < 0.01 and ** p-value < 0.001. Each Bar represents mean ± SE.

Table 1. Specific primers sequence of the target genes.

Table 1. Specific primers sequence of the target genes.

Gene SymbolPrimer SequenceSOX2OTF: GGCTGGGAAGGACAGTTCG, R: AGATGATCTTGCCAGGCGATCSOX2F: TACAGCATGTCCTACTCGCAG, R: GAGGAAGAGGTAACCACAGGGOCT4AF: GTCGAGAGCAACTCCGATG, R:TGCTCCAGCTTCTCCTTCTCNanogF: ATTCAGGACAGCCCTGATTCTTC, R: TTTTTGCGACACTCTTCTCTGCGAPDHF: AAGGTGAAGGTCGGAGTCAA, R: AATGAAGGGGTCATTGATGG