Cell lines and culture

The human pancreatic cancer cell lines PANC-1and BxPC-3 were purchased from Conservation Genetics CAS Kunming Cell Bank (Yunnan, China) and validated with short tandem repeat (STR) profiling. The human pancreatic duct epithelial cells HPDE6-C7 were obtained from China Center for Type Culture Collection (Hubei, China). Gemcitabine resistant PANC-1 subline (PANC-1/Gem-R) was purchased from China Center for Type Culture Collection (Hubei, China). PANC-1, BxPC-3 and HPDE6-C7 were cultured in RPMI-1640 containing 10% fetal bovine serum (Gibco, Cat. no.10099141C), 100 U/mL penicillin (Life Technologies, Cat. no. 15140122), and 100 mg/mL streptomycin (Life Technologies, Cat. no. 15140148). PANC-1/Gem-R cells were cultured in RPMI-1640 containing 10% fetal bovine serum (Gibco, Cat. no.10099141C), 100 U/mL penicillin (Life Technologies, Cat. no. 15140122), and 100 mg/mL streptomycin (Life Technologies, Cat. no. 15140148) and 2.5 μg/ml Gemcitabine (Selleck, Cat. no.s1714). All cells were regularly tested and confirmed for free of mycoplasma contamination using the LookOut Mycoplasma PCR detection (Sigma, Cat. No. MP0035).

Reagents and antibodies

Thymidine was purchased from Sigma (Cat. no. T1895). Bromodeoxyuridine (BrdU) was purchased from Sigma (Cat. no. B5002). 5-ethynyl-2′-deoxyuridine (EdU) was purchased from Life Technologies (Cat. no. A10044). 5-Iodo-2-deoxyuridine (IdU) was purchased from Sigma (Cat. no. I7125). 5-chloro-2′-deoxyuridine (CIdU) was purchased from Sigma (Cat. no. C6891). Hydroxyurea (HU) was purchased from Sigma (Cat. no. H8627). Gemcitabine was purchased from Selleck (Cat. no. LY-188011). (T2AG3)-Cy3-labeled peptide nucleic acid telomeric probe was purchased from PANAGENE (Cat. no. F2001). Biotin-azide was purchased from Life Technology (Cat. no. B10184). Matrigel was purchased from BD Bioscience (Cat. no. 356234). D-Luciferin was purchased from BioVision (Cat. no. 7903). Green-fluorescent caspase 3/7 probe reagent was purchased from Invitrogen (Cat. no. R37111). SYBR™ Green was purchased from Life Technologies (Cat. no. A25778). FITC Annexin V apoptosis detection kit was purchased from BD Pharmingen (Cat. no. 556547). Low melting agarose was purchased from sigma (Cat. no. A9414). CHK1 antagonist PF47736 was purchased from MedChemExpress (Cat. no. HY-10032). ATR antagonist VE-821 was purchased from MedChemExpress (Cat. no. HY-14731). HIF1α antagonist PX-478 was purchased from MedChemExpress (Cat. no. HY-10231). HIF2α antagonist PT-2385 was purchased from MedChemExpress (Cat. no. HY-12867). Glycine was purchased from Sangon Biotech (Cat. no. A100167). Aprotinin was purchased from Sigma (Cat. no. A6103). Leupeptin was purchased from Sigma (Cat. no. L2884). Subcellular Protein Fractionation Kit was purchased from Thermo fisher (Cat. no. L78840). Streptavidin-agarose beads were purchased from Thermo fisher (Cat. no. 11205D). Organoid Dissociation Solution was purchased from BioGenous (Cat. no. E238001).

The following antibodies were obtained from the indicated suppliers: Rabbit anti-RETSAT (Invitrogen, Cat. no. PA5–65443, 1:500 for immunofluorescence and 1:200 for immunohistochemistry and 1:1000 for immunoblotting). Rat anti-BrdU (Abcam, Cat. no. 6326, 1:1000 for immunofluorescence). Rabbit anti-Phospho-Histone H2A.X(Ser139) (Cell Signaling Technology, Cat. no. 9718, 1:1000 for immunoblotting and 1:500 for immunofluorescence). Rabbit anti-DDX39B (Proteintech, Cat. no. 14798–1-AP, 1:500 for immunofluorescence and 1:1000 for immunoblotting). Mouse anti-DNA-RNA Hybrid [S9.6] (Kerafast, Cat. no. ENH001, 1:200 for immunofluorescence and 1:1000 for immunoblotting). Mouse anti-dsDNA (Santa Cruz, Cat. no.sc-58,749, 1:1000 for immunoblotting). Mouse anti-CHK1 (Cell Signaling Technology, Cat. no. 2360, 1:1000 for immunoblotting). Rabbit anti-Phospho-CHK1 (Ser345) (Cell Signaling Technology, Cat. no. 2348, 1:1000 for immunoblotting). Rabbit anti-Cleaved Caspase-3 (Cell Signaling Technology, Cat. no. 9664, 1:1000 for immunofluorescence). Mouse anti-Ki67 (Vector Laboratories, cat. no. VP-K452). Rabbit anti-ATR (Cell Signaling Technology, Cat. no. 2790, 1:1000 for immunoblotting). Rabbit anti- Phospho-ATR (Ser428) (Cell Signaling Technology, Cat. no. 2853, 1:1000 for immunoblotting). Mouse anti-H2B (Abcam, Cat. no. ab204463, 1:1000 for immunoblotting). Mouse anti-GAPDH (Cell Signaling Technology, Cat. no. 97166, 1:1000 for immunoblotting). Mouse anti-CK19 (Santa Cruz, Cat. no. sc-376,126, 1:200 for immunofluorescence). Rabbit anti-SMARCAL1 (Proteintech, Cat. no. 12513–1-AP, 1:1000 for immunoblotting). Rabbit anti-BLM (Affinit, Cat. no. DF13252, 1:1000 for immunoblotting). The secondary antibodies used for immunofluorescence were raised against rat (conjugated with Cyanine3, ThermoFisher, Cat. no. A-10522), rabbit (conjugated with Alexa 488, ThermoFisher, Cat. no. A-11008; conjugated with Alexa 555, ThermoFisher, Cat. no. A32732) or mouse (conjugated with Alexa 488, ThermoFisher, Cat. no. A11029; conjugated with Alexa 555, ThermoFisher, Cat. no. A31570). The secondary antibodies used for immunoblotting were raised against rabbit (conjugated with HRP, ThermoFisher, Cat. no. 31460) or mouse (conjugated with HRP, ThermoFisher, Cat. no. 31430).

Constructs and lentiviral infection

The guide RNA (gRNA) sequences of RETSAT were obtained from GenScript’s gRNA Database (www.genscript.com/gRNA-database.html) and cloned into the lentiCRISPR v2 plasmid (Addgene plasmid # 52961) by Esp3I digestion (ThermoFisher, Cat. no. ER0451). The sequence of RETSAT gRNA was GGTGCTGGAACAACATACCA. pTomo-Luciferase-IRES-puro was constructed by replacing the RFP in pTomo-empty vector (Addgene plasmid #26291) with Luciferase by XbaI/BamHI digestion, the EGFP was replaced with puromycin resistant gene with BamHI/SalI digestion. pTomo-EF1a-Flag RNase H1 was constructed by inserting EF1α promoter in pTomo-empty by ClaI/XbaI digestion, and then inserted the 3 × Flag labeled RNase H1 fragment by XbaI/SalI digestion. The short hairpin RNAs shRNA targeting DDX39B, BLM and SMARCAL1 were cloned into the pLKO.1-TRC cloning vector plasmid (Addgene plasmid # 10878) by AgeI/EcoRI digestion. Sequences of DDX39B shRNA 1# was: Forward: 5′-CCGGCCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGGTTTTTG-3′; Reverse: 5′-AATTCAAAAACCTCAACCTCAAACACATTAACTCGAGTTAATGTGTTTGAGGTTGAGG-3′. Sequences of DDX39B shRNA 2# was: Forward: 5′- CCGGTGCCGCAAGTTCA TGCAAGATCTCGAGATCTTGCATGAACTTGCGGCATTTTTG-3′; Reverse: 5′- AATTCAAAAATGCCG CAAGTTCATGCAAGATCTCGAGATCTTGCATGAACTTGCGGCA-3′. Sequences of BLM shRNA 1# was: Forward: 5′- CCGGGACGCTAGACAGATAAGTTTACTCGAGTA AACTTATCTGTCTAGCGTCTTTTTG-3′; Reverse: 5′- AATTCAAAAAGACGCTAGACAGATAAGTTT ACTCGAGTAAACTTATCTGTCTAGCGTC-3′. Sequences of BLM shRNA 2# was: Forward: 5′- CCGGACCGAATCTCAATGTACATAGCTCGAGCTA TGTACATTGAGATTCGGTTTTTTG-3′; Reverse: 5′- AATTCAAAAAACCGAATCTCAATGTACATAGCTC GAGCTATGTACATTGAGATTCGGT-3′. Sequences of SMARCAL1 shRNA 1# was: Forward: 5′- CCGGGGAACTCATTGCAGTGTTTAACTCGAGTTAAACACTGCAATGAGTTCCTTTTTG-3′; Reverse: 5′- AATTCAAAAAGGAACTCATTGCAGTGTTTAACTCGAGTTAAACACTGCAATGAGTTCC-3′. Sequences of SMARCAL shRNA 2# was: Forward: 5′- CCGGTGCCCTCATTCTCTTCTTCAACCTCG AGGTTGAAGAAGAGAATGAGGGCATTTTTG − 3′; Reverse: 5′- AATTCAAAAATGCCCTCATTCTCTT CTTCAACCTCGAGGTTGAAGAAGAGAATGAGGGCA − 3′.

The lentiviral vectors were transfected into HEK293T cells along with the packaging plasmids pCMVΔ8.9 and pMD2.G at a ratio of 5:2.5:1 using Lipofectamine 3000 (Invitrogen, Cat. no. L3000015). Lentivirus was harvested 48 hours post transfection and filtered with 0.45 μm filter (Millipore, Cat. no. SLHV033RB). Pancreatic cancer cells were infected with lentiviruses and screened with 3 μg/mL puromycin 72 hours post infection.

Immunofluorescence

Immunofluorescence was performed as described previously [36]. Specifically, for co-localization analysis of RETSAT with BrdU-labeled replication foci, cells were pulse labeled with 10 μM BrdU for 5 minutes. After 4% Paraformaldehyde fixation and treatment with 2 N HCl (Hydrochloric acid) at 4 °C overnight, cells were washed with PBS for three times to remove residual HCl, treated with 0.3% Triton X-100 for 15 minutes, and blocked by 10% goat serum for 1 hour at room temperature. Then cells were incubated overnight at 4 °C with primary antibodies, and then labeled by fluorescent second antibodies for 1 hour at room temperature. Nucleus was stained by DAPI. Images were captured using confocal microscope system (Olympus, FV1000).

Immunoblotting

Cells were lysed in RIPA buffer containing protease inhibitor cocktail (ThermoFisher, Cat. no. 87786) and centrifuged to remove the debris. Concentration of supernatant protein was quantified with BCA method (Beyotime; Cat. no. P0009). Standard SDS-PAGE gel electrophoresis was performed, followed by blocking with 5% skimmed milk and immunoblotting with primary antibodies at 4 °C overnight. Specific signals were detected with horseradish peroxidase-conjugated secondary antibodies and chemiluminescent horseradish peroxidase substrate reagents (Millipore, Cat. no. WbKLS0500). Images were captured using automatic chemiluminescence imaging analysis system (Tanon, 5200).

Dot blotting

Cells were trypsinized and washed twice with ice-cold PBS, and lysed by cell lysis buffer (0.5% NP-40, 80 mM KCl, 5 mM PIPES) for 10 minutes. The nuclear was obtained through centrifuge at 500 x g for 5 minutes, and lysed with nuclear lysis buffer (1% SDS, 25 mM Tris-HCl pH 8.0, 5 mM EDTA) for 10 minutes. Lysis was added into 3 μL 20 mg/mL proteinase K and incubate for 3–5 hours at 55 °C. Extraction was performed twice using phenol:chloroform:isoamyl alcohol (25:24:1, pH 8.0) and chloroform, followed by 3 M sodium acetate (pH 5.2), glycogen and ice-cold 100% ethanol. After spinning down at 12,000 x g for 30 minutes at 4 °C and washing with 1 mL 70% ethanol, the pellet was resuspended into elution buffer (10 mM Tris-Cl, pH 8.5). Genomic DNA was diluted in 50 μL TE buffer and spotted onto Hybond N+ membrane (GE Healthcare) using a Bio-Dot Apparatus (Bio-Rad, Cat. no.1706545,). The membrane was blocked with 5% skim milk at room temperature after ultraviolet (UV) (0.24 J) cross-linking for 1 hour. The membrane was incubated with S9.6 antibody or dsDNA antibody overnight at 4 °C, followed by procedures as same as immunoblotting described above.

Immunohistochemistry

PDAC microarray was purchased from Shanghai Outdo Biotech (HPan-Ade180Sur-01). The clinical pancreatic tumor tissues were obtained from The Second Affiliated Hospital of Kunming Medical University. The protocol was approved by the Human Resource Use Committee of The Second Affiliated Hospital of Kunming Medical University. The immunohistochemistry (IHC) was performed as described [37]. Briefly, sections were deparaffinized and rehydrated, and antigen retrieval was performed in citric acid solution (pH 6.0) for 5 minutes at 125 °C in an autoclave. Endogenous peroxidase activity was quenched by incubation in 3% hydrogen peroxide for 15 minutes, followed by blocking in 10% goat serum for 1 hour at room temperature, incubation overnight at 4 °C with primary antibodies, and HRP-DAB staining (Beyotime, cat. no. P0202) or fluorescent secondary antibody. The slides were mounted with Aqua-Poly/Mount (cat. no. 18606; Polysciences, Warminster, PA, USA). Images were captured using Three-dimensional ultra-depth-of-field microscope VHX-6000 and Olympus optical microscope BX43.

Clone formation assay

Colony formation assay in soft agar was performed as described previously [38]. Basal agarose layer (0.8%) was prepared of 1 mL for one 6-well plate by diluting stock agar solution with growth medium and cooled at 4 °C for ~ 5 minutes. The upper agarose layer (0.48%) was mixed well with 104 cells and immediately dropped onto solidified basal layer, then cooled at 4 °C for 5 minutes. One milliliter of growth medium was added. Cells were incubated at 37 °C and 5% CO2 for 20 days. Cultural medium was refreshed every 4–7 days. The clones were staining by 0.005% crystal violet and counted using the dissecting microscope.

Cell apoptosis assay

For monolayer cultured cells, apoptosis analysis was performed by flow cytometry using FITC Annexin V apoptosis detection kit I (BD Pharmingen, Cat. no. 556547) according to manufacturer’s guidance. For 3D spheroids, apoptosis analysis was performed by green-fluorescent caspase 3/7 probe reagent and flow cytometry using FITC Annexin V apoptosis detection kit I (BD Pharmingen, Cat. no. 556547) after dissociated with Organoid Dissociation Solution (E238001), green-fluorescent caspase 3/7 probe reagent was added into medium and incubated for 30–60 minutes. The green fluorescence was observed with fluorescence microscope, the density of fluorescence was quantified with Image J software.

Real-time RT-PCR

Total RNA was extracted using Trizol reagent (sigma, Cat. no.T9424). Reverse transcription was carried out using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Cat.no.K1621). Quantitative real-time PCR was performed using SYBR Select Master Mix kit (Life Technologies, Cat. no. A25778). The primers used for RETSAT were: forward 5′-ATTGCCTTCCACACCATC-3′, reverse 5′-TTGAACAGTCCTGCGTTG-3′.

Neutral comet assay

The neutral comet assay was performed as described [39]. Briefly, 2 × 103 cells in 10 μL PBS were added into 70 μL 1% low-melting agarose at 37 °C, pipetted and evenly spread onto slide pre-coated with 0.8% agarose. The slides were incubated at 4 °C in the dark for 10 minutes, and then transferred into prechilled lysis solution (2.5 M NaCl, 100 mM EDTA, 10 mM Tris-base, 1% sodium lauryl sarcosinate, 1% Triton X-100, pH 9.5) for 60 minutes at 4 °C. The slides were then transferred to prechilled neutral electrophoresis solution (300 mM sodium acetate, 100 mM Tris, pH = 8.3) and subjected to electrophoresis at 15 V/cm, 80 mA for 30 minutes, followed by washing with distilled water and immersed in ice cold 100% ethanol at room temperature for 5 minutes and air dried. DNA was stained with DAPI for 5 minutes. Comets were analyzed using Comet Assay Software Project (CASP) (Andor Technology). A total of 150 cells from different random areas were counted per slide. Each experiment was repeated at least twice independently.

DNA fiber assay

DNA fiber assay was performed as described [40]. Specifically, replicating DNA was first labeled with 25 μM 5-iodo-2′-deoxyuridinefor for 20 minutes with or without HU treatment. Cells were then subjected to the second labeling with 250 μM 5-chloro-2′-deoxyuridine. After labeling, 2.5 μL of the cell suspension (∼2500 cells) were spotted onto one end of the glass slide, followed by addition of 7.5 μL of lysis buffer (50 mM EDTA, 0.5% SDS, 200 mM Tris-HCl, pH 7.5). After incubation for 8 minutes at room temperature, the slides were tilted to 15° to allow the DNA fibers to spread down along the slide. DNA fibers were treated with 2.5 M hydrochloric acid and incubated with rat anti-BrdU monoclonal antibody that recognizes CIdU, but not IdU at 4 °C overnight, followed by an AlexaFluor cy3-conjugated goat anti-rat secondary antibody for 1 hour at room temperature. The mouse anti-IdU monoclonal antibody that recognizes IdU but not CIdU (4 °C overnight) and AlexaFluor 488-conjugated goat anti-mouse secondary antibody (1 hour at room temperature) were used to detect IdU. DNA fibers were analyzed on a Leica DM6000B microscope equipped with a CoolSNAP HQ CCD camera (Roper Scientifics). The lengths of CIdU (AF cy3, red) and IdU (AF 488, green) labeled patches were measured using the Image J software, and μm values were converted into kb using the formula 1 μm = 2.59 kb. Two hundred fibers from different random areas were analyzed for assessment of fork dynamics.

Isolate proteins on nascent DNA (iPOND)

iPOND was performed as described [41, 42]. Briefly, pancreatic cancer cells were cultured under normal conditions with or without gemcitabine. Cells were synchronized in S phase by twice treatment of thymidine. For the first time of treatment, cells were treated with 2 mM thymidine for 18 hours, followed by release into thymidine-free medium for 10 hours. Then the second treatment was performed with 2 mM thymidine for 18 hours, and released for 6 hours. Cells were incubated with 10 mM EdU for 10 minutes. After EdU labeling, cells were treated with or without gemcitabine for 4 hours. Cells were then fixed in 1% formaldehyde, followed by quenching with 0.125 M glycine (Sangon Biotech, A100167). Cells were then collected and washed three times in ice-cold PBS, and permeabilized in ice-cold 0.25% Triton X-100/PBS for 30 minutes. Before click reaction, samples were washed once in 0.5% BSA/PBS and once in ice-cold PBS.

For click reaction, cells were incubated in click reaction buffer for 1 hour at room temperature containing 10 μM Biotin-azide. The “no-click” sample (negative control) used DMSO instead of Biotin-azide. Following the Click reaction, cells were washed once in 0.5% BSA/PBS and once in ice-cold PBS, and resuspended in lysis buffer (50 mM Tris-HCl, pH 8.0, 1% SDS) containing 1 μg/mL aprotinin (Sigma, A6103) and 1 μg/mL leupeptin (Sigma, L2884) and sonicated using a BioruptorTM UCD-200 for 60 cycles (30s pulse/ 30s pause). Samples were centrifuged at 16100×g at 4 °C for 10 minutes and the supernatant was collected. The supernatant was filtered through a 90-μm nylon mesh and diluted 1:1 (V/V) with ice cold PBS containing 1 μg/mL aprotinin and 1 μg/mL leupeptin. The input samples were collected. Streptavidin-agarose beads (Thermo fisher, 11205D) were washed three times in lysis buffer containing aprotinin and leupeptin. Two hundred microliter bead slurry was used for 1 × 108 cells. The streptavidin-agarose beads were added to the samples, which were then incubated at 4 °C for 16 hours in dark. Following binding, the beads were washed with ice-cold lysis buffer, followed by one wash with 1 M NaCl and two washes with ice-cold lysis buffer. To elute proteins bound to nascent DNA, the 2× SDS Laemmli sample buffer (2× SB) mix (0.4 g SDS, 2 mL 100% Glycerol, 1.25 mL 1 M Tris, pH 6.8 and 0.01 g Bromophenol blue in 8 mL H2O) was added to packed beads (1:1; V/V). Samples were incubated at 95 °C for 25 minutes, followed by immunoblotting or mass spectrometry detection.

Mass spectrometry assay

The purified proteins were separated by SDS-PAGE and visualized by silver staining. The gel was then cut into small pieces. Disulfide bonds were reduced, thiols were alkylated, and proteins were digested according to the in-gel trypsin digestion protocol [43]. The extracted peptides were dried, resuspended in 0.1% trifluoroacetic acid, desalted with C18 ZipTips, dried again, and dissolved in 0.1% formic acid.

An Orbitrap Elite hybrid mass spectrometer (MS) with an electrospray ionization inlet (Thermo Fisher) was used to analyze the peptide samples using a previously described method [44]. Briefly, samples were separated on a C18 analytical column through a nanoscale HPLC with solution A of 0.1% formic acid and solvent B of 80% acetonitrile and 0.1% formic acid. The HPLC gradient was 6 to 44% solvent B for 90 minutes. The automatic data acquisition in positive ion mode in MS was used to collect the 15 strongest ions in each precursor MS scan. Each precursor ion was analyzed twice in 60 seconds. The resolution for the precursor ion was set to 120,000 at 200 m/z and the isolation window of the selected precursor ion for MS/MS analysis was set to 2 m/z.

The MS/MS raw files were searched with Proteome Discoverer (version 2.1, Thermo Fisher Scientific) against the Human UniProt database (www.uniprot.org) with concatenated reverse protein sequence and common contaminants. The parameters used to identify tryptic peptides for the protein identification were a 10 ppm precursor-ion mass tolerance, 0.6 Da production mass tolerance. Enzyme specificity was set to trypsin and a maximum of 2 missed cleavages per peptide were allowed. The cysteine carbamidomethylation was set as fixed modification and methionine oxidation and N-terminal acetylation as variable modifications. The 1% FDR at both peptide and protein levels was applied for the analysis. Relative protein quantification was based on the label-free quantification included in the Proteome Discoverer software package. The Abundance of the protein was obtained from each sample.

Co-immunoprecipitation

Co-immunoprecipitation (Co-IP) was performed as described previously [36]. Specifically, PANC-1 cells were harvested and washed twice with ice-cold PBS and lysed with 1× RIPA lysis buffer (Beyotime, P0013D) containing complete EDTA-free (Roche) inhibitors. Immunoprecipitation with RETSAT antibody performed on and with Lysates were digested by 10 units/mL DNase I (New England Biolabs, M0303), and incubated with anti-RETSAT primary antibody overnight. Isotype IgG were used as negative controls. Immunoprecipitation was carried out using protein A/G Agarose Resin (Yeasen, 36403ES08) according to the manufacturers’ protocol. After pulling down and wash, proteins were fractionated by SDS-PAGE gel for immunoblotting.

3D spheroid culture

3D culture of pancreatic cancer cells was performed as previous described [45]. Briefly, Matrigel was diluted with serum-free culture medium to a final concentration of 7 mg/mL. One hundred microliter diluted Matrigel was added into each well of 96-well plate and incubated for 60 minutes in 37 °C for solidification. Pancreatic cancer cells were seeded onto Matrigel at a density of 5000 cells/well. Gemcitabine was added the next day post cell seeding and maintained for a total of 7 days, with a midweek change of fresh medium.

PDAC organoids culture

Primary human PDAC organoids were established from two PDAC surgical biopsies in The Second Affiliated Hospital of Kunming Medical University as previously described [46,47,48]. Briefly, human PDAC tissues were rinsed with DPBS twice and minced into small fragments of 1–3 mm3, followed by digestion with 10 mL of tumor tissue digestion solution (BioGenous, K601003) in a 15 mL conical tube at 37 °C for variable incubation times ranging from 30 min to 90 min. Cells were filtered using a 100 μm cell strainer and centrifuged at 250×g for 3 min at 4 °C. Cells were resuspended with AdDMEM/F12 (Invitrogen,12,634–010) and Growth Factor reduced (GFR) Matrigel (Corning, 356,231). Thirty microliter matrigel containing approximately 10,000 cells was loaded onto the bottom of 24-well plates and incubated at 37 °C and 5% (vol/vol) CO2 for 25 min for solidification. The culture medium was composed of AdDMEM/F12 (basal medium), 1 M HEPES, 1x GlutaMax (Invitrogen, 35,050–061), 1% penicillin/streptomycin (Invitrogen, 15,140,122), 1x B27 (Invitrogen, 17,504,044), 1 mM N-acetyl-L-cysteine (Sigma-Aldrich, 9165), 100 ng/mL Wnt-3a (R&D Systems, 5036-WN-010), 100 ng/mL R-Spondin 1 (Peprotech, 120–38), 100 ng/mL Noggin (Invitrogen, 120-10C), 50 ng/ml epidermal growth factor (Peprotech, AF-100-15), 100 ng/mL fibroblast growth factor (Peprotech, C100–26), 10 mM Nicotinamide (Sigma, N0636), 10 μM Y-27263 (Sigma, Y0503) and 0.5 μM A83–01 (R&D Systems, 2939/10).

Cell Derived Xenograft (CDX) model

Animal care and experimental protocols were approved by the Institutional Animal Care and Use Committee of Kunming Institute of Zoology, Chinese Academy of Sciences. Five to six-week-old B-NDG (NOD-Prkdcscid IL2rgtm1/Bcgen) mice were purchased from Jiangsu Biocytogen Co., Ltd. (Nantong, China) and kept under specific pathogen-free environment. PANC-1 cells were infected with lentivirus expressing Luciferase and selected with 3 μg/mL puromycin for 7 days. 1 × 106 cancer cells in 100 μL PBS containing 30% Matrigel were injected into each B-NDG mouse subcutaneously. To monitor tumor growth by bioluminescent imaging in vivo weekly, the mice were intraperitoneally injected with 150 mg/kg D-Luciferin and imaged using IVIS system followed by analyzed with Living Image software (Caliper Life Science, IVIS Lumina Xr, USA). Mice were treated with 100 μL of vehicle (saline) or gemcitabine at dose of 50 mg/kg by intraperitoneal injection weekly. The mice were sacrificed before tumor volume reached to approximately 2000 mm3.

Statistical analysis

Statistical analysis was performed using GraphPad Prism 9 software (GraphPad Inc., San Diego, CA, USA). Quantitative data are represented as mean ± s.e.m. unless otherwise stated. Comparisons between two groups were analyzed by two tailed Student’s t-test for statistical significance. One-way analysis of variances was applied for multiple comparisons. Experiments were repeated three times unless otherwise stated. No samples or animals were excluded from any analyses and all replicates were authentic biological replicates. Animals were randomly assigned to treatment of gemcitabine. Blind analysis was not performed in this study. P < 0.05 was considered as significant.