Cell Culture

FLO1 and OE33 cell lines were a kind gift from Dr. David Beer (University of Michigan, Ann Arbor, MI). SK-GT-4 cell line was kindly provided from Dr. Xiaochun Xu (MD Anderson Cancer Center, Houston, TX). Human CP-B cells were obtained from ATCC. OE33 cells were maintained in RPMI 1640 media (GIBCO), supplemented with 10% fetal bovine serum (FBS) (GIBCO), and 1% penicillin/streptomycin (GIBCO). FLO-1 and SK-GT-4 cells were maintained in DMEM media (GIBCO) containing 10% FBS and 1% penicillin/streptomycin. CP-B cells were maintained in DMEM-F12 media (GIBCO) containing 5% FBS, 1% penicillin/streptomycin, bovine pituitary extract, hydrocortisone, recombinant epidermal growth factor, 1X insulin transferrin selenium supplement and L-adenine. All cells were grown at 370C in a humidified incubator with 5% CO2. All cell lines were regularly authenticated and tested for mycoplasma contamination, using mycoplasma detection Kit (PCR) purchased from SouthernBiotech.

Antibodies and reagents

A list of all primary and secondary antibodies used in this study is provided in Table 1.

Table 1 Primary and secondary antibodies used in this study

The APE1 redox-specific inhibitor E3330 was purchased from Novus Biologicals (NBP1-49,581, Centennial, CO, USA).

Transfection and lentivirus infection

Scrambled si-RNA (sc-29470) was purchased from Santa Cruz Biotechnology. APE1 si-RNA (L-010237–00-0005) was obtained from Dharmacon (Lafayette, CO, USA). The flag-tagged coding sequence of APE1 was cloned in pcDNA3.1 mammalian expression plasmid (Invitrogen, Carlsbad, CA, USA). APE1 redox-deficient mutant (C65A) was developed by QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA). The flag-tagged coding sequence of YAP1 was cloned in pcDNA3.1 mammalian expression plasmid (Invitrogen, Carlsbad, CA, USA). The mammalian expression HA-Ubiquitin plasmid was purchased from Addegene (Addgene plasmid # 18,712; http://n2t.net/addgene:18712; RRID: Addgene18712) [25]. For transient overexpression of APE1 or YAP1, mammalian expression plasmids or empty vector were transfected into OE33 and FLO-1 cells using PolyJet reagent (SignaGen Laboratories, Rockville, MD, USA). For transient knockdown of APE1, si-APE1 or scrambled si-RNA were transfected into OE33 and FLO-1 cells using LipoJet reagent (SignaGen Laboratories, Rockville, MD, USA). Cells were harvested within 72 h of transient transfection.

Acidic bile salts treatment

Bile salts (BS) cocktail was prepared by mixing equal concentrations of glycocholic acid (GCA), taurocholic acid (TCA), glycodeoxycholic acid (GDCA), glycochenodeoxycholic acid (GCDCA) and deoxycholic acid (DCA). Cells were treated with 200 μM BS cocktail in corresponding acidic culture media (pH 4.0, ABS) for 20 min, followed by recovery in regular media.

Cycloheximide chase assay

OE33 and FLO-1 cells were pre-treated with 100 μg/mL cycloheximide (CHX) for 2 h followed by exposure to ABS (pH 4, 200 μM) for 20 min before lysates were collected at different time points and analyzed for APE1 and YAP1 protein levels by Western blot. OE33-scramble and OE33-si-APE1 cells were treated with 100 μg/mL CHX and whole cell lysates were collected at different time points and analyzed by Western blot.

Sphere formation assay

Single-cell suspension of OE33 cells was counted, and a density of 2000 cells/well was suspended in cold Growth Factor Reduced Matrigel™/ serum-free RPMI-1640 medium (1:1) in a total volume of 50 µl [26]. Each experimental condition was performed in triplicate. The master mix of cells with Matrigel™ was plated at the rim of the well of a 24-well plate and allowed to solidify in the incubator at 37 °C for 45 min. RPMI media containing 5% FBS (with or without treatment) was added gently at the center of the well. Media or treatments were replenished every two days. Sphere counts and imaging were performed at day 10 of sphere culture.

Western blot analysis

Cells were lysed in RIPA lysis buffer (sc-24948, Santa Cruz, CA, USA). Protein extracts were quantified using the DC Bio-Rad Protein Assay (Bio-Rad Laboratories, Hercules, California, USA) according to the manufacturer’s protocol. Protein samples were mixed with 4X Laemmli sample buffer and heated at 85 °C for 10 min for gel electrophoresis. An equal amount of protein lysate was separated on 10% SDS–PAGE for 90 min at 100 V then transferred onto nitrocellulose membrane (Bio-Rad, CA, USA). Membranes were blocked with 5% BSA for 1 h and then incubated overnight at 4 °C with the primary antibody (refer to Table 1 for antibody source and dilution). Membranes were then washed three times with 1X TBST and incubated with the corresponding secondary antibody for 1 h at room temperature. Target proteins were detected using commercial Immobilon Western Chemiluminescent HRP Substrate detection reagents (ThermoFisher Scientific). Images were generated and quantified using ChemiDoc™ Imaging Systems (Bio-Rad, CA, USA).

Immunoprecipitation

Cells were lysed in Pierce™ IP Lysis Buffer (ThermoFisher Scientific) supplemented with 1 × Halt protease inhibitor cocktail and 1 × Halt phosphatase inhibitor cocktail (ThermoFisher Scientific). Cell lysates were rotated together with Protein G Magnetic beads and 2ug of antibody or control IgG at 4 °C overnight. The immunocomplexes were then washed eight times with PBST buffer (PBS containing 0.1% Tween® 20) and subject to western blot analysis as described previously.

Ubiquitination Assay for Mammalian Cells

Cells were co-transfected with HA-Ubiquitin plasmid and Flag YAP1 using Polyjet. Cells were then treated with 10 µM MG132 (Sigma-Aldrich) for 6 h and harvested within 72 h of transfection. Cells were then lysed and immunoprecipitated with Flag antibody (Sigma-Aldrich) as mentioned before. Samples were then subject to western blot analysis with anti-ubiquitin antibody (Cell signaling) to determine the primary proteins’ ubiquitination levels.

Proximity ligation assay

In situ protein–protein interactions were detected using the Duolink in situ proximity ligation assay (PLA) detection kit (Sigma-Aldrich) following the manufacturer’s instructions. Cells were cultured in 8-well chamber slides for 24 h and then washed with PBS and fixed with 4% paraformaldehyde for 45 min at room temperature. Cells were then permeabilized with 0.5% Triton X-100 in PBS for 10 min, blocked for 1 h in a humidity chamber at 37 °C, and incubated overnight at 4 °C with the two primary antibodies raised against the two proteins of interest, each from a different host species. The primary antibodies (APE1, Rabbit monoclonal, ThermoFisher Scientific; β-TrCP, Mouse Monoclonal, ThermoFisher Scientific) were used. Hybridization, ligation, washing, and detection steps were performed following the supplier’s protocol. After final washes in buffer B, cells were mounted using the Duolink in situ mounting medium with DAPI, sealed with nail polish, and allowed to dry for 15 min at room temperature before imaging using the All-in-One Fluorescence Microscope (BZ-X700, Keyence Corp, Atlanta, GA).

Cell fractionation

Cells were transfected with scramble or si-APE1 then treated with 200 μM ABS for 20 min followed by recovery in regular media at different time points. Cells were trypsinized and processed for cytosol and nuclear separation following the manufacturer’s protocol (ThermoFisher Scientific, USA). Briefly, cells were trypsinized, washed with 1X PBS, and centrifuged at 500 g for 5 min. The pellet was then resuspended in cytoplasmic extraction reagent I (CER I), vortexed for 15 s and incubated on ice for 10 min. Cytoplasmic extraction reagent II (CER II) was then added, followed by vortexing and centrifugation at 16,000 g for 5 min. The supernatant was collected as the cytosolic fraction. The pellet was resuspended nuclear extraction reagent (NER), vortexed for 15 s, incubated on ice for 40 min with vortexing every 10 min, and centrifuged at 16,000 g for 10 min. The resulting supernatant was collected as the nuclear fraction. The isolated cytosolic and nuclear fractions were mixed with the 4X Laemmli sample buffer and electrophoresed using SDS-PAGE.

Quantitative real-time RT-PCR

Total RNA was extracted using Direct-zol RNA Miniprep Plus Kit according to manufacturer’s protocol. Total 1 μg/sample RNA was subjected to cDNA synthesis using the iScript™ cDNA Synthesis Kit (Biorad). The primers used were designed using primer 3 online tools (http://bioinfo.ut.ee/primer3-0.4.0/primer3/) and were obtained from Integrated DNA Technologies (Coralville, Iowa). Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out using an iCycler (Biorad laboratories). All reactions were performed in triplicates. The fold expression was calculated and normalized to the average CT value of HPRT housekeeping gene. The real-time PCR primers were purchased from Integrated DNA Technologies (IDT, Coralville, IA). Primer sequences were as follows: APE1 (Forward: GCTTCGAGCCTGGATTAAGA; Reverse: TTGGTCTCTTGAAGGCACAGT), YAP1 (Forward: GATGAACTCGGCTTCAGGTC; Reverse: TTGGGTCTAGCCAAGAGGTG), CTGF (Forward: TGGAGATTTTGGGAGTACGG; Reverse: CAGGCTAGAGAAGCAGAGCC), CYR61 (Forward: CCCGTTTTGGTAGATTCTGG; Reverse: GCTGGAATGCAACTTCGG), ANKRD1 (Forward: AGCCCTCATGCTTGCTGTAT; Reverse: TTTGTTCATGAATGTGATGAAATC), HPRT (Forward: ACCCTTTCCAAATCCTCAGC; Reverse: GTTATGGCGACCCGCAG).

Luciferase reporter assay

Cells were transfected with scramble or si-APE1 using lipojet transfecting agent. The next day cells were co-transfected with 8xGTIIC-luciferase plasmid (Addgene plasmid # 34,615; http://n2t.net/addgene:34615; RRID: Addgene_34615) [27], as a measure of YAP/TEAD transcription activity, along with renilla as the internal control using polyjet DNA transfecting agent. 48 h after transfection, cells were treated with a 200 μM mixture of acidic bile salts (pH4) for 20 min and allowed to recover for 3 h in complete medium. The cells were harvested and lysed with 1X luciferase passive lysis buffer. A FLUOstar OPTIMA microplate reader (BMG LABTECH, Cary, NC) was used to measure luciferase activity after adding the luciferase reagent and renilla after adding the stop solution using a dual-luciferase reporter assay system (Promega). Luciferase activity was calculated by normalizing the luciferase with the corresponding renilla value and reported as relative luciferase activity.

Immunocytochemistry of embedded spheres

Paraffin-embedded sphere slides were deparaffinized and rehydrated following standard protocols. Antigen retrieval was performed by boiling the slides in 1 mmol/L Tris EDTA, pH 8.0 for 20 min. Slides were allowed to cool down to room temperature before incubation in 10% normal goat serum blocking solution (Thermo Fisher Scientific) for 1 h. Slides were incubated with primary antibodies overnight at 4 °C in a humidified chamber. Slides were washed with PBS and incubated with secondary antibody (Alexa Fluor 488 and Alexa Fluor 568) for 1 h at room temperature. Finally, slides were washed and mounted using mounting medium with DAPI (Abcam; ab104139). Fluorescent signals were captured using BZ-X710 KEYENCE All-in-One Fluorescence Microscope.

Immunofluorescence staining

Cells were seeded in 6 well plates on coverslips. The cells were washed with PBS and treated with ABS (200 μM for 20 min), washed again with PBS, and allowed to recover for 3 h in complete medium. Cells were fixed with 4% paraformaldehyde for 45 min, and then permeabilized with 0.5% Triton X-100 for 10 min. The cells were then washed, blocked using goat antiserum for 20 min at room temperature and then incubated with primary antibody anti-YAP (1:100 dilution) and anti-APE1 (1:200 dilution) overnight. Cells were washed and incubated with the secondary antibodies Alexa Fluor 488 goat anti-mouse and Alexa Fluor 568 goat anti-rabbit (1:200) for 1 h at room temperature. Cells were finally washed and mounted with mounting medium containing DAPI (Abcam; ab104139). Images were captured using the BZ-X710 KEYENCE All-in-One Fluorescence Microscope.

Immunohistochemistry (IHC)

Paraffin-embedded tissue slides were deparaffinized and rehydrated following standard protocols. Slides were then immersed for 20 min in boiling citrate buffer for antigen retrieval. Anti-APE1, anti-YAP1 and IHC Select Immunoperoxidase Secondary Detection System (DAB500, Millipore sigma) were utilized for staining following manufacturer’s instructions. IHC results were evaluated for intensity and frequency of the staining. The intensity of staining was graded as 0 (negative), 1 (weak), 2 (moderate) and 3 (strong). The frequency was graded from 0 to 4 by the percentage of positive cells as follows: grade 0, < 3%; grade 1, 3–25%; grade 2, 25–50%; grade 3, 50–75%; grade 4, > 75%. The index score was the product of multiplication of the intensity and frequency grades, which was then classified into a 4-point scale: index score 0 = product of 0, index score 1 = products 1 and 2, index score 2 = products 3 and 4, index score 3 = products 6–12.

Animal experiments

All animal studies were conducted using protocols approved by the Institutional Animal Care and Use committee of the University of Miami (UM-20–110). The pL2-IL1β transgenic mice are a kind gift from Dr. Timothy Wang (Columbia University). It is a model of chronic esophageal inflammation that develops BE and EAC, as previously described [28]. The Mice were divided into 2 groups, untreated and bile salt, each containing 8 mice. The treated group received drinking water containing 0.3% deoxycholic acid (DCA) at neutral pH at the age of three months. After 7 months of continuous DCA administration, the mice were sacrificed and subjected to histological analysis of the squama-columnar junctions at the gastro-esophageal junctions.

De-identified patient-derived xenografts (PDXs) from human gastro-esophageal junction were generated according to our previously described platform [29]. PDX GTR0165 was used in the experiment. Samples were cut to a uniform size and implanted subcutaneously into bilateral flanks. Tumors were measured every other day until tumor volume reached approximately 150 mm3. The mice were then randomized into 2 groups, untreated and E3330, each containing 5 mice. E3330 was delivered via oral gavage (OG) at a dose of 20 mg/kg every weekday for 4 weeks. E3330 was dissolved in Cremophor: EtOH (1:1) (Cremophor was purchased from Sigma, Cat # C5135) for stock solution generation and diluted in PBS before injection. Tumor growth was determined by measuring the width and length of the tumors with an electronic caliper every 3 days. Body weights were measured every 7 days to monitor for drug toxicity. Tumor volume was calculated using the following formula: tumor volume (mm3) = 1/2 (W)2 x (L). At the experimental treatment endpoint of 4 weeks, mice were followed for survival. These mice were sacrificed once tumors reached 1000 mm3. A Kaplan–Meier survival estimate was performed with a log-rank calculation to determine statistical significance.

Statistical analysis

All the statistical analyses were performed using GraphPad Prism, version 8.0 (GraphPad Software). Differences were analyzed by student’s t-test or one-way ANOVA followed by the Bonferroni post-hoc test. Results were reported as mean ± SD. P value < 0.05 was considered statistically significant. **, p < 0.05. ***, p < 0.01. N.S., no significance.