Animals

Adult male Wistar rats weighing 150–180 g were obtained from the Laboratory Animal Center at Shandong University. All the rats were housed 3–4 per cage, had free access to food and water and were maintained under conditions with a temperature of 22 ± 2 °C and a 12-h light/dark cycle. The animals were acclimatized to these conditions for 7 days prior to use in the experiment. Strict procedures were implemented to mitigate the pain and suffering and the least number of rats needed to perform valid statistical analyses were used in each part of the study.

Materials

See Supplementary Table 1.

CCI Surgery

After anesthetizing the rats with sodium pentobarbital (50 mg/kg body, intraperitoneal injection), the lateral portion of the sciatic nerve was exposed by bluntly dissecting the left biceps femoris muscle. At the proximal end of the trigeminal branch of the sciatic nerve, approximately 6 mm of the nerve was separated from the adherent tissue. Four surgical wires were then used to ligate the nerve at intervals of approximately 1 mm, resulting in a ligation extending 4.5 mm in length along the nerve. An identical procedure was performed in rats of the Sham group, with the exception that the sciatic nerve was not ligated. After surgery, the muscle, lumbar dorsal fascia and skin were sutured sequentially. Surgeries were performed under aseptic conditions. Rats demonstrating self-mutilation or total sensory loss following the surgery were eliminated from the experiment.

Behavioral Tests

Animals were subjected to behavioral testing on their ipsilateral hind paw both before and after surgery (Supplementary Figure S1). For the behavioral tests, rats were placed in individual Plexiglas containers with a wire mesh at the bottom and acclimatized to this test environment for approximately 30 min as described previously [21]. With use of a mechanical pain meter (kw-CT-1, Calvin biotechnology, Nanjing, China), sufficient force was applied vertically to the middle plantar surface of the left hind foot with von Frey filaments. The demonstration of a rapid retraction or licking of the foot were considered as positive responses when assessing the paw withdrawal threshold (PWT).

To assess their paw withdrawal latency (PWL), rats were positioned inside a 5-mm thick Plexiglas container. Following a 30-min acclimatization period, radiant heat was applied through the glass to the surface of the left hindfoot using a thermal nociceptor (KW600 Calvin Biotechnology, Nanjing, China). In accordance with the method used by Hargreaves et al. to evaluate thermal nociceptive sensitization [22], the PWL was defined as the time between the application of radiant heat and the onset of a positive response as indicated by a licking or retracting of the hind paw. An automated 20-s timer was set to terminate the radiant heat if the rat did not withdraw its rear paw in order to avoid tissue damage. The experiment was replicated three times with 5-min intervals between each test. The mean score obtained in the three tests was used for statistical analyses. To reduce experimental bias, behavioral tests were conducted under blind conditions.

Intrathecal Injection

Intrathecal injections into the subarachnoid space between the L4 and L5 vertebrae were administered to sedated rats using a 10-gauge needle. The precise site was confirmed by the observation of tail flicking. The mTOR inhibitor, rapamycin (RAPA, 50 μg/kg), and the RIP3 inhibitor, GSK872 (GSK, 100 μg/kg), were dissolved in DMSO and administered once daily on days 7–9 after CCI surgery.

The siRNA against rat TSC2 (target sequence: GTGCTGGAAGCTGATGCGAAA) and the triple-target tandem siRNA against rat mTOR (target sequence: AGGAGTCTACTCGCTTCTATG-ATTGAGTTGGGCTCTCTCACTTCT-CCAAGTGGAACTGCTTATCA) were synthesized by the Shanghai Genechem Technology Co.. Lentiviral vectors LV-GFP-TSC2-RNAi and LV-GFAP-EGFP-MIR155(mTOR)*3–1 containing the GFAP-specific promoter were constructed and stored at − 80 °C. Following removal from the freezer the virus solutions were dissolved by gentle shaking at 37 °C and the titer of the virus solution was adjusted to 1 × 108 TU/mL with saline. Rats in each group were injected intrathecally at one week prior to CCI surgery. The negative control (NC) virus and lentiviral vector groups were injected intrathecally with 10 μl volumes for 10–30 s of NC-shRNA and lentiviral solution, respectively. The needle remained in place for 5 min following the infusion and was then slowly retracted. The L4–L5 spinal dorsal horn and the dorsal root ganglion (DRG) were collected at 3 weeks after virus inoculation to allow for a maximal and stable expression of their effects.

Cell Culture and Treatments

Human embryonic kidney 293 T cells (CRL-3216, ATCC) and the rat astrocyte cell line (CTX TNA2, Jennio Biotech) were cultivated in DMEM supplemented with 10% endotoxin-free fetal bovine serum and incubated at 37 °C in 95% O2 and 5% CO2. Cells were grown to 70–80% fusion prior to treatment.

For the in vitro experiments, astrocytes were incubated with GSK (5 μM) for 24 h, chloroquine (CQ, 10 μM) for 18 h, SAR405 (10 μM) for 24 h or MG132 (10 μM) for 6 h, with Earle’s balanced salt solution (EBSS) medium applied for 0, 6 or 12 h to induce autophagy via amino acid starvation.

Transfection

Astrocytes were grown to 20% fusion before transfection with LV-TSC2-shRNA. Lentiviral suspensions (moi = 5) were diluted with complete medium and the infection enhancement solution HiTransG P as provided by the reagent vendor was added. The cells were then incubated at 37 °C and after 16 h the complete medium was replaced and the incubation continued. GFP fluorescence in cells was monitored by fluorescent microscopy (Leica, Solms, Germany) at 72 h after transfection. Puromycin (2 μg/ml) was used to screen the cells, which were then subcultured.

ITCH-siRNA and NC-siRNA were transfected into astrocytes. The positive strand sequence of ITCH-siRNA was 5′-GAGCAAUGCAGCAGUUUAATT-3′ and the antisense strand sequence was 3′-UUAAACUGCUGCAUUGCUCTT-5′. Furthermore, pcDNA3.1-RIP3-C-FLAG and pcDNA3.1-ITCH-C-HA were transfected into 293 T cells. The lipofectamine 3000 reagent was used according to the manufacturers’ instructions. Cells were cultivated to 70–80% fusion prior to transfection. After fully combining the siRNA or plasmids with lipofectamine 3000, it remained at room temperature for 20 min at which time DMEM was added to the cells. The medium was changed to the complete medium 24 h after transfection, before any treatment was administered.

Co-Immunoprecipitation (Co-IP)

Cell lysates were prepared using IP buffer (200:1 mixture of IP Cell lysis buffer and Phenylmethanesulfonyl fluoride). RIP3 (1 μg) and IgG (1 μl) antibodies were added to the IP samples and the mixture was incubated for 2 h on a rotator at 4 °C. Each sample received 40 μL of protein A/G agarose beads, which were rotated overnight at 4 °C. Samples were eluted three times with IP Cell lysis buffer. IgG was utilized as the negative control.

Western Blotting

The L4–L5 spinal dorsal horn tissue samples and cultured cells were homogenized in RIPA lysis buffer. Proteins were obtained by centrifugation at 12,000 rpm for 20 min at 4 °C and were then applied onto a polyvinylidene fluoride membrane after being separated on a 10% SDS-PAGE gel. The following antibodies were used to incubate the membranes overnight at 4 °C after they were blocked with 5% skim milk: Rabbit anti-mTOR, Rabbit anti-p-mTOR, Rabbit anti-GFAP, Rabbit anti-RIP3, Rabbit anti-GAPDH, Rabbit anti-GS, Rabbit anti-TSC2, Mouse anti-Ub, Rabbit anti-ITCH, Rabbit anti-p62, Rabbit anti-FLAG, and Rabbit anti-HA antibody. The blots were visualized with use of an enhanced chemiluminescence system (Millipore) and Image J software (National Institutes of Health, MD, USA) was used to analyze the signal intensities.

Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

RT-qPCR was used to assess gene expressions in the tissue samples or cells. With use of RNA extraction kits, total RNA was extracted from these tissue samples or cells (Fastagen Biotech, Shanghai) and cDNA was then synthesized in accordance with the guidelines provided by the manufacturer (GeneCopoeia). The pre-denaturation step was performed at 95 °C for 30 s. Then, 40 cycles of 95 °C for 10 s and 60 °C for 30 s each comprised the PCR amplifications. Target gene expression levels in each sample were normalized using GAPDH mRNA expression, and relative mRNA levels were assessed using the comparative CT method (2-ΔΔCT). Supplementary Table 2 lists the primer sequences that were employed (Biosune, China).

Immunohistochemistry Analysis

The L4–L5 spinal cord tissue samples were preserved in 4% paraformaldehyde, and then embedded and sectioned into tissue slices with a thickness of 5 μm. Slices were rehydrated in graded alcohol solutions after being deparaffinized in xylene. The primary antibody: Rabbit anti-TNF-α antibody, was incubated with these spinal cord slices. After incubation with a secondary antibody at 37 °C for 60 min, the sections were treated in diaminobenzidine (DAB, ZSGB-BIO technology, Beijing) for 60 min and then counterstained with hematoxylin. The immunohistochemistry images were obtained with use of a biological microscope (Nikon, Tokyo, Japan) and ImageJ software was used to calculate optical densities to quantify these results. The absolute intensities, as obtained with the control group, were used to standardize each group’s measurements with the Image J software.

Immunofluorescence Staining

For immunofluorescence, the spinal dorsal horn, the DRG or cells were incubated with primary antibodies overnight at 4℃: Rabbit anti-p-GFP, or Rabbit anti-TSC2, or Rabbit anti-mTOR, or Rabbit anti-p-mTOR, or Rabbit anti-p-JNK, or Goat anti-C3d, or Rabbit anti-c-fos, or Rabbit anti-RIP3, or Rabbit anti-p62, and Mouse anti-p-mTOR, or Mouse anti-GFAP, or Mouse anti-IBA1, or Mouse anti-NEUN, or Mouse anti-ITCH antibody. Following three PBS washes, the sections or cells were incubated for 1 h at room temperature with a combination of fluorescence-conjugated secondary antibodies (1:200, Abbkine) and were then were stained with DAPI for 5 min. Images were captures with use of a Nikon fluorescent microscope. ImageJ software was used to quantify results of sections as described previously [23]. The total number of double-positive cells within a 436.18 μm*327.14 μm section of the spinal dorsal horn was counted and the number of double-positive cells per square millimeter was calculated. For double fluorescence staining of cells, Image J software was used to provide quantitative values for the analyses of fluorescent intensities. Absolute intensities were standardized, as based on the absolute intensity of the control group.

Statistical Analysis

GraphPad Prism software, version 6 (GraphPad Software, San Diego, CA, USA) was used to analyze all the data, which were expressed as the means ± standard errors. An unpaired Student’s t-test was used for comparisons involving two groups while a one-way analysis of variance (ANOVA) was used for comparisons involving three or more groups, with Bonferroni’s test used for post-hoc pairwise comparisons following a statistically significant ANOVA. For all analyses, a P < 0.05 was required for results to be considered as statistically significant. All analyses were performed by an investigator who was blinded as to the source of the data.