Data collection

RNA sequencing data and corresponding clinical information were obtained from The Cancer Genome Atlas (TCGA) data portal (https://portal.gdc.cancer.gov/repository). The clinical data included age, gender, disease stage, tumor grade, overall survival time, and vital status (alive/deceased). Samples with missing clinical data were excluded from the analysis. Additionally, normal pancreas control samples were procured from the Genotype-Tissue Expression (GTEx) Project pancreas dataset (https://www.gtexportal.org/). A total of 178 pancreatic cancer samples were collected from TCGA, and 167 normal pancreas samples were obtained from GTEx.

Identification of disulfidptosis-related lncRNAs in pancreatic cancer

Disulfidptosis-related genes (DRGs) were curated from the existing literature. To identify the disulfidptosis-related lncRNAs (DRLs), Pearson correlation analysis was performed. A stringent filtering criterion was employed, selecting lncRNAs with an absolute correlation coefficient (|corFilter|) greater than or equal to 0.3 and a P-value less than or equal to 0.001. This analysis identified a total of 173 DRLs in pancreatic cancer.

Construction and validation of the DRL signature

A total of 178 pancreatic cancer samples obtained from TCGA were randomly divided into training and testing groups. The prognostic value of DRLs was evaluated using univariate Cox regression analysis within the training group. DRLs with statistically significant associations (P < 0.05) were then selected for further analysis using least absolute shrinkage and selection operator (LASSO) Cox regression and multivariate Cox regression analysis. Finally, a risk signature based on the identified DRLs was constructed in the training group. The risk scores of samples were calculated as follows:

$$\text=\Sigma [\text(\text) \times \text(\text)]$$

where Exp denotes the expression level of lncRNAs and coef represents the corresponding coefficient for each lncRNA. Following the calculation, samples in both the training and testing groups were stratified into high- and low-risk groups based on the median risk score.

Prognostic analysis of the risk signature

To investigate the difference in survival time between the high- and low-risk groups, we employed the 'survmine' and 'survival' R packages. We further assessed the predictive performance of the risk signature by generating receiver operating characteristic (ROC) curves and evaluating the area under the ROC curve (AUC) using the 'timeROC' R package. Univariate and multivariate Cox proportional hazards models were utilized to perform independent prognostic analysis.

Cell culture and reagents

Human PDAC cell lines HPNE, AsPC-1, MIA PaCa-2, SW-1990, Patu8988, and PANC-1 were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). MIA PaCa-2, SW-1990, Patu8988, and PANC-1 were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S). HPNE and AsPC-1 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 culture medium supplemented with 10% FBS and 1% P/S. These cells were maintained at 37 °C and 5% CO2 in a humidified incubator.

Cell transfection

For the cell transfection assay, cells were seeded in 6-well plates and allowed to adhere overnight. Subsequently, each well was transfected with a combination of siRNA targeting CASC8 and the transfection reagent Lipo2000 (ThermoFisher, USA) according to the manufacturer's instructions. Following a 48-h incubation period, the cells were harvested for further experimentation. The knockdown efficiency of the siRNA was verified using quantitative real-time PCR (qRT-PCR). The siRNA sequences employed were as follows: si-CASC8-1, 5′‐GGACCAGGAGCACUAGUTT‐3′, si-CASC8-2, 5′‐GCAUGCAGCGAAUGCUCTT‐3′.

Knockdown and overexpression assay

The lentivirus against CASC8 was purchased from Tsingke (Beijing, China), and the sequences targeting CASC8 were: sh‐1, 5′‐GCAAGAAGAGAGACCTTCATA‐3′, sh‐2, 5′‐CAGCTTCTGAGCATCCGAATA‐3′. For the CASC8 and c-Myc overexpression assay, the NR_117100.1 and NM_002467.6 sequences were utilized. The Ubi-MCS-SV40-PURO and pLKO.1-LUC-PURO vectors were employed for CASC8 overexpression and knockdown experiments, while the SV40 vector was used for c-Myc overexpression. For lentiviral transduction, cells were cultured in a 6-well plate, followed by the addition of lentiviral suspensions. 48 h post-transduction, the culture medium was supplemented with 5 µg/mL puromycin to facilitate the selection of stable cell lines.

Cell counting kit-8

For the cell proliferation assay, cells were seeded into 96-well plates at a defined density. Subsequently, a solution of CCK-8 reagent (CCK-8, ShareBio, China) diluted to 10% in serum-free medium was added to each well at predetermined time points (0, 1, 2, 3, and 4 days). Following incubation for 1 h, the absorbance of the culture medium was measured at 450 nm using a Power Wave XS microplate reader (BIO-TEK). The resulting data were used to generate proliferation curves with GraphPad Prism 8.0 software.

Colony formation assays

For the colony formation assay, 3000 cells were plated onto 6-well plates. Following a two-week incubation period, colonies were fixed with a 4% paraformaldehyde fixation solution. Subsequently, colonies were stained with 0.5% (w/v) crystal violet and quantified using ImageJ software.

EdU (5‐ethynyl‐2′‐deoxyuridine)

For the EdU assay, cells were seeded onto chambered coverslips (Ibidi, 80826). After a 24-h incubation period, the medium was supplemented with EdU working solution (ShareBio, China, SB-C6015) for 2 h at 37 °C in a 5% CO₂ environment. Subsequently, the chambers were fixed with 4% paraformaldehyde fix solution for approximately 15 min at room temperature. Following the manufacturer's instructions, the EdU-positive cells were visualized and captured using a confocal microscope (Leica, Germany). In parallel, flow cytometry was employed to quantify the proportion of EdU-positive cells. The EdU Flow Cytometry Assay Kit (ShareBio, China, SB-C6020) was used according to the manufacturer's instructions.

Quantitative real‐time PCR

Total RNA was isolated from cells using TRIzol reagent (Takara Bio, China). The isolated RNA was then reverse-transcribed into cDNA using the PrimeScript RT Master Mix reagent (Takara Bio, China), following the manufacturer's instructions. Quantitative real-time PCR (qRT-PCR) was performed using Universal SYBR Green qPCR Premix (ShareBio, China) on a 7500 real-time PCR system (Applied Biosystems, USA). The cycling conditions recommended by the manufacturer were employed. Relative mRNA expression levels were calculated using the 2−ΔΔCT method. 18S ribosomal RNA was chosen as the internal reference gene for normalization. The primer sequences are listed in the supplementary table.

Western blotting

Cells were lysed using RIPA buffer (Thermo Fisher Scientific, USA) to extract total protein. The proteins were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes. Following the transfer, the membranes were blocked with 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween-20 (TBST) for approximately 1 h at room temperature. After blocking, the membranes were incubated with primary antibodies diluted in TBST containing bovine serum albumin (BSA) or non-fat dry milk to prevent non-specific binding. Specific primary antibodies used were: β-actin (Abcam, ab8227, 1:5000), GLUT1 (Proteintech, 21,829–1-AP, 1:1000), ENO1 (Proteintech, 11,204–1-AP, 1:2000), GPI (Proteintech, 15,171–1-AP, 1:1000), LDHA (Proteintech, 19,987–1-AP, 1:2000), HK2 (Proteintech, 66,974–1-Ig, 1:5000), and c-Myc (Proteintech, 10,828–1-AP, 1:2000). Following incubation with primary antibodies, the membranes were washed in TBST and then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies (goat anti-mouse IgG, ShareBio, 1:5000; goat anti-rabbit IgG, ShareBio, 1:5000) in TBST containing BSA or non-fat dry milk for 1 h at room temperature. Finally, protein bands were visualized using enhanced chemiluminescent (ECL) reagents (ShareBio, China).

Transwell chamber assays

For transwell migration assay, 4 × 104 cells were resuspended in a serum-free medium and seeded onto the upper chamber of the transwell insert. The lower chamber was filled with a medium containing 10% FBS, which served as a chemoattractant. Following a 48-h incubation period, the transwell chambers were fixed with 4% paraformaldehyde solution for 15 min at room temperature to preserve cell morphology. Subsequently, the cells were stained with 0.5% crystal violet solution to visualize migrated cells. Finally, the number of migrated cells was quantified using ImageJ software.

Flow cytometry

For flow cytometry assay, 2 × 105 cells were seeded into 6-well plates and cultured in a complete medium either containing or lacking glucose for 12 h. To investigate the effect of disulfide stress on cell death, Dithiothreitol (DTT) and tris-(2-carboxyethyl)-phosphine (TCEP), two reagents known to prevent disulfide stress, were added to specific cultures. Following treatment, cells were collected and stained with propidium iodide (PI), a fluorescent dye that can only enter dead cells with compromised membranes. Dead cells were then identified and quantified using a flow cytometer (BD AccuriTM C6 Plus cell analyzer, BD Biosciences, USA). Flow cytometry data was analyzed using FlowJo 10.4 software to determine the percentage of PI-positive cells, representing the proportion of dead cells in the population.

Fluorescent staining of actin filaments

Cells were seeded onto chambered coverslips (Ibidi, 80,826) and adhered overnight. Subsequently, the cells were fixed with 4% paraformaldehyde for 15 min at room temperature to preserve their morphology. After fixation, the cells were permeabilized with 0.5% Triton X-100 for 5 min at room temperature to facilitate antibody access to intracellular antigens. The cells were then washed three times with phosphate-buffered saline (PBS) to remove residual fixative and permeabilization buffer. Following washing, the cells were stained with 100 nM Actin-stain 555 phalloidin (Thermo Fisher Scientific, USA) for approximately 30 min to visualize the F-actin cytoskeleton. After incubation, the cells were washed three times with PBS to remove unbound phalloidin. Nuclei were then counterstained with DAPI (Thermo Fisher Scientific, USA) for 5 min to visualize DNA. Finally, the coverslips were mounted onto slides, and images were captured using a confocal microscope (Leica, Germany).

Glucose consumption assay

PDAC cells were seeded into 6-well plates and cultured for approximately 24 h. Following incubation, the culture medium was collected, and the remaining glucose concentration was measured using the BioVision Glucose Uptake Assay Kit (BioVision, K676) according to the manufacturer's instructions. The amount of glucose uptake by the cells was then calculated by subtracting the remaining glucose concentration in the culture medium from the initial glucose concentration (typically provided by the manufacturer). To normalize for cell number, the glucose uptake values were normalized to the total protein content of the cells, which was determined using a bicinchoninic acid (BCA) assay.

NADP+ and NADPH measurement

The intracellular NADP+ and NADPH levels were determined using the NADP+/NADPH Assay Kit (Beyotime, China, S1079), following the manufacturer's instructions. Briefly, PDAC cells were seeded into 6-well plates and cultured for approximately 24 h. The culture medium was then discarded, and the cells were lysed using the NADP+/NADPH extraction reagent provided in the kit. The NADP+/NADPH ratio in the cell lysates was then measured according to the kit instructions.

Human PDAC sample collection

Primary PDAC tissues were collected from patients diagnosed with PDAC who were undergoing treatment at Huadong Hospital, Fudan University. All patients provided written informed consent prior to tissue collection in accordance with ethical guidelines. Pathological data associated with the tissue samples were obtained from the Pathology Department.

Subcutaneous and orthotopic xenograft models

Six- to eight-week-old male athymic nude (nu/nu) mice were used to establish subcutaneous and orthotopic xenograft tumor models. For the subcutaneous xenograft model, PDAC cells were resuspended in 100 μL of sterile PBS and subcutaneously injected into the flank region of the mice. After four weeks of inoculation, tumors were surgically resected, and their weights were measured. For the orthotopic xenograft model, mice were anesthetized using isoflurane according to institutional guidelines. Subsequently, PDAC cells were resuspended in 50 μL of sterile PBS and directly injected into the pancreas of the mice. Following four weeks of inoculation, the mice were euthanized, and tumors were excised, fixed in a 4% paraformaldehyde solution, weighed, and photographed.

Immunofluorescence (IF) assay

For immunofluorescence analysis of patient tumor tissues, samples were fixed in 4% paraformaldehyde solution, embedded in paraffin wax, and subsequently processed for IF staining. The primary antibody used was specific for CK19 (Servicebio, GB15198-100, 1:500). DAPI (Servicebio, G1012) was used for a 5-min counterstain of the nuclei to visualize DNA. For IF analysis of PDAC cells, cells were seeded onto chambered coverslips (Ibidi, 80,826) and cultured for 24 h. Subsequently, the cells were fixed with 4% paraformaldehyde solution for 10 min at room temperature to preserve their morphology. After fixation, the cells were permeabilized with 0.5% Triton X-100 for 5 min to facilitate antibody access to intracellular antigens. Following permeabilization, the cells were blocked with 5% BSA for 1 h at room temperature to prevent non-specific antibody binding. The cells were then incubated with primary antibodies specific for GLUT1 (Proteintech, 21,829–1-AP, 1:200) and c-Myc (Proteintech, 10,828–1-AP, 1:200) overnight at 4 °C. Following incubation with primary antibodies, the cells were washed and incubated with a secondary antibody (goat anti-rabbit IgG) for 1 h at room temperature. Finally, the cells were stained with DAPI (Servicebio, G1012) for 5 min to visualize nuclei. Digital images were captured using confocal microscopes (Leica, Germany).

Immunohistochemistry (IHC) and TUNEL assay

For IHC analysis, xenograft tumors were fixed in a 4% paraformaldehyde solution, embedded in paraffin wax, and subsequently processed for IHC staining. Primary antibodies specific for c-Myc (Servicebio, GB13076-50, 1:200) and Ki-67 (Servicebio, GB121141-100, 1:300) were used to stain the tissue sections. The Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay was performed to identify apoptotic cells in paraffin sections of mouse xenografts. A TUNEL kit (Servicebio, GB1507-50 T) was used according to the manufacturer's instructions.

Chromogenic in situ hybridization (CISH)

CISH was performed on tissue sections following established protocols. Briefly, the sections underwent deparaffinization and dehydration to remove embedding media. This was followed by antigen retrieval, a process that enhances the accessibility of target molecules for probe binding. Subsequently, the sections were treated with protease K, an enzyme that digests proteins and facilitates probe penetration. After pre-hybridization to create optimal conditions for probe binding, the sections were hybridized with a solution containing specific DNA probes complementary to the target RNA sequence. Following hybridization, the sections were washed to remove unbound probes and then blocked with rabbit serum to prevent non-specific antibody binding. The target RNA was then visualized using a colorimetric detection system. Finally, the sections were counterstained with a nuclear stain, sealed with a coverslip, and imaged using a microscope.

RNA sequencing

Total RNA was extracted from MIA PaCa-2 cells in both the control group and the CASC8 knockdown group (n = 3) using the TRIzol reagent (Invitrogen, CA, USA) according to the manufacturer’s instructions. Then the libraries were constructed using VAHTS Universal V6 RNA-seq Library Prep Kit according to the manufacturer’s instructions. The libraries were sequenced on a llumina Novaseq 6000 platform and 150 bp paired-end reads were generated. Raw reads were firstly processed using fastp (v0.22.0) and the low-quality reads were removed to obtain the clean reads. The clean reads were mapped to the reference genome using HISAT2 (v2.1.0). FPKM of each gene was calculated and the read counts of each gene were obtained by featureCounts. The transcriptome sequencing and analysis were conducted by OBiO Technology Corp., Ltd. (Shanghai, China).

RNA immunoprecipitation

The antibodies utilized included anti-c-Myc (Proteintech, 10,828–1-AP) and anti-IgG (Abclone, AC005). Briefly, cell samples were harvested from a 15 cm culture plate when the cell confluence reached 80–90% using 250 μL of cell lysis buffer. The A/G magnetic beads were washed twice and incubated with anti-IgG and anti-c-Myc at room temperature for 1 h. A 20 μL sample from each lysate was collected and stored at -80 °C as RNA input. Subsequently, 100 μL of lysate was added to the prepared anti-IgG beads, while an additional 100 μL of lysate was added to the anti-c-Myc beads. These beads were incubated overnight at 4 °C with rotation. The magnetic beads were then washed six times with 1 mL of wash buffer. The resuspended beads were collected for RNA isolation using phenol: chloroform: isoamyl alcohol (125:24:1) reagent. Each RNA sample was reverse-transcribed for subsequent qPCR analysis.

Metabolism analysis

The MIA PaCa-2 CASC8 knockdown cells, SW-1990 CASC8 overexpression cells, and their respective control cells (n = 3) were washed with PBS under 37 °C for three times and the PBS was removed. The sample was proceeded with trypsinization for 2 min, then serum medium was added to stop the reaction. The cells were collected into a new centrifuge tube, and centrifuged at 14000 g for 5 min to remove supernatant. The cell pellets were washed with PBS under 4 °C for three times, and centrifuged at 14000 g for 5 min to remove the PBS. Then the cell pellets were quickly frozen in liquid nitrogen and immediately proceeded with extraction or store the material at -80 °C. 1000 μL methanol/acetonitrile/H2O (2:2:1, v/v/v) were added to homogenized solution for metabolite extraction. The mixture was centrifuged for 15 min (14000 g, 4 °C). The supernatant was dried in a vacuum centrifuge. For LC–MS analysis, the samples were re-dissolved in 100 μL acetonitrile/water (1:1, v/v) solvent. Analyses were performed using an UHPLC (1290 Infinity LC, Agilent Technologies) coupled to a quadrupole time-of-flight (AB Sciex TripleTOF 6600) in OBiO Technology Corp., Ltd. (Shanghai, China).

Statistical analysis

The bioinformatics analysis was performed using R software (version 4.0.2) for numerical data analysis and visualization. Data were presented as mean ± standard deviation. Statistical significance between groups was determined using appropriate tests, including Chi-square, Student's t-test, or ANOVA. For survival curve analysis, the Log-rank test was used. All in vitro experiments were repeated at least three times, and a P-value threshold of 0.05 was used to define statistical significance.