THP-1 cell culture

THP-1 cells were purchased from ATCC (TIB-202) and cultured in RPMI medium (ThermoFisher, 51800-019) supplemented with 10% FBS superior stabil (Bio&Sell, S 0615) and 1% Penicillin (100 U mL− 1)/Streptomycin (100 µg mL− 1; Gibco, 15070-063). The differentiation protocol was modified from Surdziel et al. [30]. In brief, THP-1 monocytes were split (day 1) and respective cell numbers were seeded according to the cell culture dish (0.5 × 106 cells mL− 1). For differentiation to macrophages, phorbol-12-myristat-13-acetat (PMA; Sigma, P8139-1MG, 20 ng mL− 1) solved in dimethyl sulfoxide (DMSO, Sigma Aldrich, 276855-100ML, 100%) was added and renewed after 24 h. On day three, the medium was exchanged and macrophage polarization was initiated. M0 macrophages received plain medium; to obtain M1-like macrophages - interferon gamma (IFN-γ; Peprotech, AF-300-02, 20 ng mL− 1) and lipopolysaccharide (LPS; Sigma, L8274, 100 ng mL− 1) were added, for M2a-like macrophages the medium was supplemented with interleukin-4 (IL-4; Peprotech, AF-200-04, 20 ng mL− 1) and for M2c-like macrophages with IL-10 (Peprotech, AF-200-10, 50 ng mL− 1). On day 5, the THP-1 derived macrophages were used for experiments.

Isolation and differentiation of CD14+ cells

Peripheral blood mononuclear cells (PBMCs) from healthy donors were isolated as described in Sieve et al. [32]. In brief, the filters from platelet apheresis received form the blood transfusion service at Hannover Medical School were perfused with 50 mL of PBS (Sigma-Aldrich; P4474) and loaded with 12.5 mL of Biocoll Separating Solution (1.077 g mL-1, Biochrom, L6715). Subsequently, the mononuclear cells were pelleted (300 g for 30 min at room temperature (RT)), transferred and resuspended in PBS. Following an additional centrifugation step (300 g for 10 min), the cells were counted. To isolate CD14+-cells, MACSⓇ technology was used in accordance with the manufacturing protocol using anti-human CD14-MicroBeads (Miltenyi Biotec, 130-050-201). 1 × 106 cells mL-1 were seeded into RPMI 1640 medium (Gibco, 21870076) supplemented with 10% FBS (Biochrom, S 0615) and 1 mM L-glutamine (Gibco, 25030081). Basal cells were cultured during the whole experiment in plain medium. To differentiate the cells into M1-like cells, granulocyte macrophage colony-stimulating factor (GM-CSF; Peprotech, 300-03, 50 ng mL-1) was added. To gain M2-like macrophages, macrophage colony-stimulating factor (M-CSF; Peprotech, 300 − 25, 50 ng mL-1) was supplemented. The medium and stimuli were renewed on day four of the differentiation. On day 2, 4, 7, and 10, the cells were utilized for 5-HT7R mRNA experiments, whereas all other experiments were performed on day 7 after seeding.

Flow cytometry

THP-1-derived macrophages were washed with prewarmed PBS, incubated with 0.25% Trypsin-EDTA (1X), phenol red (Invitrogen, 25200-56) for 10 min at 37 °C and detached by gentle pipetting. Cells were pelleted (400 g, 5 min, 4 °C) and suspended in 1 mL autoMACS Rinsing Solution (Miltenyi Biotec, 130-091-222). All stainings were performed with 1 × 107 cells and centrifugation steps were performed at 400 g for 5 min at 4 °C. Blocking was done with donkey serum (1:100, Jackson Immunoresearch, 017-000-121) or Human TruStain FcX (1:100, Biolegend, 422301) for 5 min, followed by centrifugation and incubation with antibody mix (PE/Cyanine7-anti-human CD11b (Biolegend, 301321), PerCP/Cyanine5.5-anti-human MERTK (Biolegend, 367621), APC-anti-human HLA-DR (Biolegend, 307610), PE-anti-human CD86 (B7-2; eBioscience, 12-0869-41); BV421-anti-human CD163 (BD, 562643), PE/Dazzle 594-anti-human CD105 (Biolegend, 323223), Alexa Fluor 700-anti-human CD14 (Biolegend, 367113), PE-anti-human CD200R (Biolegend, 329306), FITC-anti-human CD64 (Invitrogen, 11-0649-42) for 20 min at 4 °C, washing, centrifugation and resuspension in autoMACS Rinsing Solution. Stained cells were measured at Sony Spectral cell analyzer SA3800 using FCS Express 6 software for data analysis.

Western blot

THP-1 cells were differentiated as described above and lysed on day 5 of differentiation. Adherent cells (M0, M1, M2a, and M2c) were washed once with cold PBS before adding RIPA lysis buffer and supplemented with protease inhibitors CLAP and PMSF. Cells were detached using a cell scraper and lysates were transferred into reaction tubes. Undifferentiated THP-1 cells in suspension were centrifuged at 700 rpm for 7 min and washed once with PBS. The cell pellet was resuspended in lysis buffer. All lysates were centrifuged at 15 000 g at 4 °C for 15 min and the supernatant was used for further experiments. Protein concentrations were determined using Pierce BCA Protein Assay Kit (Thermo scientific, 23225) according to the manufactures protocol. Supernatants were mixed with 6x Nick loading buffer with β-mercaptoethanol (Carl Roth, 4227.1, 5%) and loaded on an SDS-gel (12%) run at 140 V. After separation, the proteins were transferred onto nitrocellulose membranes (Cytiva, 10600003) and blocked for 1 h at RT with milk powder (5%) in TBS-T. Membranes were incubated overnight with following primary antibodies: 5-HT7R (1:1000, Abcam, 128892), Gαs (1:500, Abcam, ab101736), Gα12 (1:250, Santa Cruz, sc-515545), Cdc42 (1:500, 610929, BD Biosciences, in SignalBoost™Immunoreaction Enhancer Kit, Merck Millipore, 407207), GAPDH (1:5000, Millipore, MAB374) in milk (5%), if not differently specified. Membranes were washed three times with TBS-T and incubated with corresponding secondary antibodies (all 1:10000 in milk (5%), goat anti-rabbit IgG (H + L) HRP (Thermo Fisher Scientific, 31460), rabbit anti-mouse IgG Fc HRP (Thermo Fisher Scientific, 31455), rabbit anti-goat IgG (H + L) HRP (Thermo Fisher Scientific, 31402)) for 1 h. The western blots were developed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 3457734096), SuperSignal West Pico Plus Chemiluminescent Substrate (Thermo Fisher Scientific, 34577), or Immobilon ECL Ultra Western HRP Substrate (Merck, WBULS0100) respectively at Fusion SL Vilber Lourmat (PeqLab). For quantification of the band signals, a custom-written Matlab script was used and normalization was done by the sum of replicates method.

Quantitative real-time polymerase chain reaction (qRT-PCR)

RNA from THP-1-derived macrophages was isolated using RNeasy Mini Plus Kit (Qiagen, 74134) whereas RNA from CD14+ was harvested using TRIzol Reagent (Thermo Fisher Scientific, 15596026). The RNA was transcribed with either SuperScript® III First-Strand Synthesis System (Invitrogen, 18080-051) or LunaScript™ RT SuperMix Kit (NEB, E3010L). For detection of differentiation marker expression an AriaMx Realtime-PCR System (Agilent Technologies, Software Agilent Aria 1.5) with Maxima SYBR Green qPCR Master Mix (2x) (ThermoScientific, K0253) was used. The respective sequences of the utilized primers are listed in Table 1.

Expression levels of 5-HT7R signaling pathway components in THP-1-derived macrophages were determined on a StepOne Plus System (Applied Biosystems) with either TaqMan Universal PCR Master Mix (Applied Biosystems, 4324018) or Luna® Universal Probe qPCR Master Mix (M3004L, NEB). The following Taqman Gene Expression Assays (Thermofisher), primers and probes were used: 5HT7R (Hs00909028_g1), Gα12 (Hs00170899_m1), Cdc42 (forward: AGAAAAGTGGGTGCCTGAGAT, reverse: AATTTGAGTCCCAACAAGCAA, probe: GTCACCACTGRCCAAAGACTCCTT), Gαs (Hs00255603_m1), and β-actin (Hs99999903_m1). Relative mRNA expression levels were calculated using the 2−∆∆CT method.

Immunocytochemistry and microscopyBright field

Differentiated THP-1 cells were imaged in a 48-well plate using bright field at Zeiss Axio Oberver.Z1/7, with Zen 3.2 Blue software (Carl Zeiss, Jena).

Immunofluorescence staining and imaging

THP-1-derived macrophages were grown on glass cover slips and fixed using paraformaldehyde (PFA, Carl Roth, 0335.3, 4%) for 10 min at RT, permeabilized with acetone for 3 min at -20 °C, washed with PBS and unspecific binding sites were blocked with albumin fraction V (Carl Roth, T844.4, 1%) in PBS for 1 h at RT. Afterwards, cells were incubated with anti-5HT7 Receptor/HTR7 (extracellular)-FITC antibody (1:400 in PBS, Alomone Labs, ASR-037-F) or 5HT7 Receptor/HTR7 (extracellular) Blocking Peptide (1:10 ratio to the antibody according to the manufacturers recommendations; Alomone Labs, BLP-SR037) for 1 h at RT. Nuclei were stained using DAPI (1:5000, Sigma Aldrich, D9542) for 5 min at RT. Cover slips were mounted with Fluoromount-G (Biozol, SBA-0100-01,) and sealed with clear nail polish after 24 h. Imaging was performed at Zeiss LSM780 confocal microscope using Zen black (2012 SP5) software (Carl Zeiss, Jena). Five regions per cover slip were selected and analyzed.

Morphological analysis

THP-1 cells were differentiated as described above and stimulated using LP-211 (Sigma Aldrich, SML1561-5MG, 10 µm) solved in DMSO or DMSO for control at day 3, respectively. Cell surface was stained using Cell Mask Plasma Membrane Stain (1:100, Life Technologies, C37608) in tyrode buffer according to manufacturer’s protocol. In short, on day 5 after seeding cells were washed with prewarmed PBS and incubated for 10 min at 37 °C with the staining solution. Cells were subsequently washed with PBS and imaged in tyrode buffer at Zeiss LSM780 confocal microscope (Carl Zeiss, Jena). Images of single cells with the main morphology (M0 – round, M1 – stretched, M2a – enlarged, M2c – enlarged) were separated using the MotiQ ImageJ/Fiji plugin [33, 34]. Quantification of shape and protrusions was performed in ImageJ/Fiji by manually drawing segmented lines and using the inbuild “measure” tool for measuring length and numbers. All values < 1 μm were excluded from analysis.

Scratch assay

For the scratch assay, 2 × 105 cells per 48 well were seeded and differentiated as described above. On day5, medium was renewed and cells were stimulated using LP-211 (10 µm, in DMSO) or DMSO (10%), respectively. The confluent cell layer was scratched in a vertical line using a p200 pipet tip. Recovery of wounded area was documented using Zeiss Axio Oberver.Z1/7, with Zen 3.2 Blue software (Carl Zeiss, Jena). For quantification of the recovered area, Fiji Wound healing size tool was modified [35]. Experiments with recovered areas less than the mean recovered area of M2c-like macrophages under control stimulation were excluded from analysis.

Phagocytosis assay

A phagocytosis assay was performed as described in Sieve et al. [32]. In short, THP-1 and CD14+ cells were differentiated and stimulated with LP-211 (10 µm, in DMSO) or DMSO (100%) for control on day 3 or 5 after seeding. The inhibitors ZCL278 (Tebubio, T1855, 50 µm solved in DMSO), Y-27632 (Merck, 688000, 10 µm solved in DMSO), SQ22536 (MedChemExpress, HY-100396, 100 µm solved in DMSO) were added 30 min prior LP-211 (10 µm, in DMSO) treatment in THP-1-derived M1-like macrophages to analyze the impact of different signaling pathways. Cells were stimulated again after 24 h and subsequently incubated with 1 × 106 particles of Zymosan A (S. cerevisiae BioParticles™-Texas Red™ conjugate, ThermoFischer, Z2843). On day 5 or 7 after seeding, cells were incubated with Hoechst 33342 (1:2000 in culture medium, Invitrogen, H3570) for 15 min at 37 °C and washed twice with prewarmed PBS. Fluorescence intensities were measured at Cytation5 image reader (BioTek) and quantified with Gene5 Image Prime 3.11 software (BioTek). Relative phagocytosis rate was calculated automatically by the software.

Multiplex assays of THP-1-derived macrophages

On day 5 after seeding and differentiation, THP-1-derived macrophages were changed into plain medium and treated with DMSO or LP-211 (10 µm solved in DMSO) respectively. After 24 h, on day 6, the stimulation was renewed. On day 7, supernatant was collected, centrifuged at 1000 g for 15 min at 4 °C and stored at -80 °C until measurement. Supernatants were analyzed using Bio-Plex Pro Human Inflammation Panel 1, 27-Plex (BioRad, M500KCAF0Y) with the Bio-Plex 200 system (Bio-Rad). For normalization, cells were lysed as described above for Western Blot and Pierce BCA Protein Assay Kit (ThermoFisher scientific, 23225) was used to determine protein concentrations. Measured chemokine and cytokine concentrations were normalized to corresponding protein concentration of the sample. Analysis was performed on values within the standard range of each analysis. Analytes with one value were excluded from the analysis. Principle component analysis was performed using GraphPad Prism version 11. Analytes with values below the lowest value of the standard were include with the half minimal concentration of each standard [36].

Statistical analysis

The presented data are shown as mean ± standard deviation (SD). Statistical analysis was performed using GraphPad Prism version 11. All data were subjected to outlier analysis and normal distribution tests. Applied statistical tests are indicated in the respective figure legends.