Cell lines and culture

HT1080, HeLa, HT29, MCF-7, MDA-MB-231 and HEK293T cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured according to the manufacturer’s instructions. DR-U2OS and EJ5-U2OS cells were kindly provided by Dr. Lei Shi (Tianjin Medical University). PORCN-null and control HT1080 cells were kindly provided by Dr. David M. Virshup (Duke-National University of Singapore). These cells were cultured in DMEM supplemented with 10% foetal bovine serum (FBS), 100 U/ml penicillin and 100 U/ml streptomycin and were maintained at 37 °C in a humidified atmosphere with 5% CO2.

Plasmid construction, lentivirus production, and transfection

The target sequence of PORCN used to construct lentiviral shRNAs was 5′-ATCTTCTACCGTCTCATAGT-3′ (shPORCN). For rescue experiments, PORCN-WT and a PORCN-ΔNLS construct (mutations underlined: ATATTTTATCGCCTAATCGT) resistant to the shRNA used (ATCTTCTACCGTCTCATAGT) were synthesized by Genewiz from Azenta Life Sciences. The target sequence of Ku70 used to construct lentiviral shRNAs was 5′-GATGAGTCATAAGAGGATCAT-3′ (shKu70). For rescue experiments, a Ku70-WT construct (mutations underlined: AATGTCCCACAAACGCATAAT) resistant to the shRNA used (GATGAGTCATAAGAGGATCAT) was cloned and inserted into a pLenti-Hygro vector. The QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) was used to generate the Ku70-C66S, C150S, C389S, C398S, C585S and 5 C/S plasmids. To generate stable PORCN- or Ku70-knockdown cell lines, HEK293T cells were used to produce retrovirus by cotransfection with PORCN shRNA or Ku70 shRNA packaged in the pCMV-VSVG, pRsv-REV and pMDlg-pRRE plasmids using Lipofectamine 3000. Forty-eight hours after transfection, retroviruses were harvested. To generate stable cell lines, HT1080 cells were infected with retroviruses in the presence of polybrene (8 µg/mL). Cells were then selected with puromycin (0.7 µg/mL) or hygromycin B (400 µg/mL).

Generation of PORCN knockout (PORCN-KO) and NLS knockout (NLS-KO) cell lines

For PORCN deletion, we designed two sgRNAs targeting a common sequence in all PORCN transcripts to delete a large fragment of PORCN-CDS. The sgRNA sequences were as follows: gRNA-A3: CTGGGTAGAGGGCGTAGCCAGGG and gRNA-A4: CAGGGAGCGCAGATATATGGGGG. By analysing the PORCN genome, we found that the NLS sequence occupies the entire exon 6 of PORCN. Thus, for PORCN NLS deletion, we deleted exon 6 of PORCN in HT1080 cells using CRISPR/Cas9 gene editing. Two sgRNAs were designed to delete the fragment. The sgRNA sequences were as follows: gRNA-A1: CTCAGAACTGGGGAAACCGCGGG and gRNA-A2: GCTGGCTGGCTGACGAAGCTTGG. The positive monoclony was obtained after PCR and sequencing verification.

Irradiation

For ionizing radiation, a 6 MV X-ray linear accelerator (600CD, Varian, USA) was used at a dose rate of 2.3 Gy/min for the in vitro studies.

Colony formation assay

Different numbers of HT-1080 cells were cultured in 6-well plates and treated with various doses of IR. The cells were then cultured for 10–14 days. The colonies were then fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. Colonies with more than 50 cells were counted as surviving colonies. Plating efficiencies and surviving fractions were calculated.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) staining

MTT (Acros Organics, NJ, USA) was added to the cell culture medium at a 1:10 ratio. The cells were then placed back in the incubator until the MTT was metabolized. PBS was then added to the medium at a 1:10 ratio, and the plates were covered and kept overnight at 4 °C. Absorbance was read at 570 nm by a Synergy 4 plate reader (Biotek, Winooski, VT, USA).

Immunofluorescence microscopy

To detect γ-H2AX foci, exponentially growing cells on coverslips were treated with 0–5 Gy IR. At the indicated timepoint after IR, the cells were fixed in 4% paraformaldehyde at 4 °C, permeabilized with 0.2% Triton X-100 and blocked with 5% BSA. The cells were then incubated with a rabbit anti-γ-H2AX antibody (#9718, Cell Signaling Technology) overnight at 4 °C. The cells were then incubated with a fluorescently labelled goat anti-rabbit secondary antibody (35560, Thermo Scientific) for 1 h at room temperature. DAPI staining (blue) was used to visualize the DNA among the bound antibodies detected by confocal microscopy (Olympus BX61, Japan). At least 100 cells from each experiment were randomly selected to count the number of γ-H2AX foci in each nucleus.

HR and NHEJ reporter assays

DR-U2OS or EJ5-U2OS cells were harvested 48 h after transfection with I-SceI and other indicated plasmids. They were resuspended in 0.5 ml of PBS for fluorescence-activated cell sorting analysis. The ratio of GFP-positive cells was determined to assess repair efficiency.

Comet assay

Cells were mixed gently with low-temperature-melting agarose at a volume ratio of 1:50 (v/v) and spread onto glass slides. The slides were then incubated in lysis buffer at 4 °C for 30 min before they were electrophoresed in running buffer at 1.0 V/cm for 15 min and stained with Subgreen in TE buffer (1:10000).

Giemsa staining

Cells were fixed with 70% ethanol and stained with Giemsa stain solution (G4640, Solarbio, Beijing, China).

G2/M checkpoint assay

To test the activation of the G2/M checkpoint, cells were harvested and fixed in 70% ethanol, permeabilized with 0.1% Triton X-100 (Sigma) on ice for 10 min and blocked in 1% bovine serum albumin for 30 min. The fixed cells were then incubated with an anti-phospho-histone-H3-Ser10 antibody (#53348; Cell Signaling Technology) for 1 h and a fluorescein isothiocyanate–conjugated secondary antibody for 30 min in the dark. In the final step, the cells were stained with 50 µg/ml propidium iodide and analysed using a fluorescence-activated cell sorting Calibur flow cytometer (Becton, Dickinson and Company) with CellQuest software (Becton, Dickinson and Company).

Cell subcellular fractionation assay

Different cellular compartments of HT1080 cells were isolated using a commercial Subcellular Protein Fractionation Kit (78840, Thermo Scientific). Briefly, gently mix the cell pellet and CEB together, then incubate the tube at 4 °C for 10 min. Centrifuge for five minutes at 500 ×g. Quickly move the cytoplasmic extract, or supernatant, to a sterile, ice-filled tube that has been previously refrigerated. To the pellet, add ice-cold MEB with protease inhibitors. Using the highest setting, vortex the tube for 5 s. Gently stir the tube while it is incubating at 4 °C for 10 min. Centrifuge for five minutes at 3000 ×g. Place the membrane extract, or supernatant, in a clean, previously refrigerated tube and set it on ice. To the pellet, add ice-cold NEB that has protease inhibitors in it. 15 s at the maximum vortex setting. Gently mix the tube and incubate it for 30 min at 4 °C. Centrifuge for five minutes at 5000×g. Place the nuclear extract fraction (supernatant) in a clean, ice-filled tube that has been previously refrigerated. To make the chromatin-bound extraction buffer, mix 3µL of 300-unit Micrococcal Nuclease and 5µL of 100-milligram CaCl2 with 100µL of room-temperature NEB. To the pellet, add room temperature NEB that contains micrococcal nuclease, CaCl2, and protease inhibitors. 15 s at the maximum vortex setting. Incubate for fifteen minutes at room temperature or five minutes in a water bath at 37 °C. Following the incubation period, centrifuge the tube at 16,000 ×g for 5 min and vortex on the highest setting for 15 s. Place the chromatin-bound nuclear extract (supernatant) fraction in a clean, ice-filled tube that has been previously refrigerated. To the pellet, add room temperature PEB that contains protease inhibitors. 15 s at the maximum vortex setting. For ten minutes, incubate at room temperature. For five minutes, centrifuge the tube at 16,000 ×g. In a fresh tube, transfer the supernatant. The isolated fractions were processed for Western blot analysis.

Immunoprecipitation, LC-MS/MS and western blot analysis

Cells were collected, washed with cold PBS, and lysed in RIPA buffer (50mM Tris, 150mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, pH 7.4). Cell lysates were then immunoprecipitated with the indicated antibodies and protein A/G Sepharose overnight and eluted with Laemmli buffer after washing. The interacting proteins of PORCN were analysed and visualized on SDS-PAGE gel by silver staining following the manufacturer’s protocol (24600, Thermo Scientific). Each gel lane was divided into fractions and digested with trypsin. The tryptic peptides were analysed by liquid chromatography-MS/MS using an LTQ Orbitrap Velos Pro ion-trap mass spectrometer. For Western blot, protein lysates were separated using SDS-PAGE (8–12%) and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked in 5% non-fat dry milk in Tris-buffered saline and Tween 20 (TBST) for 2 h at room temperature and then incubated overnight at 4 °C with primary antibodies against PORCN (ab105543, Abcam), DNA-PKcs (ab70250, Abcam), pDNA-PKcs(S2056)(ab124918, Abcam), Ku70 (ab202022, Abcam), Ku80 (ab80592, Abcam), α-Tubulin (ab18251, Abcam), Histone H1 (ab203337, Abcam), Rad50 (#3427, Cell Signaling Technology), γ-H2AX (#9718, Cell Signaling Technology), Flag (F1804, Sigma), GFP (50430-2-AP, Proteintech), Streptavidin-HRP (21130, Pierce), LRP6 (#3395, Cell Signaling Technology), p-LRP6(S1490) (#2568, Cell Signaling Technology), ATM (#2873, Cell Signaling Technology), pATM(S1981) (#5883, Cell Signaling Technology), Total β-Catenin(#8814, Cell Signaling Technology), Free β-Catenin(#9561, Cell Signaling Technology), GAPDH (#5174, Cell Signaling Technology) and β-actin (#3700, Cell Signaling Technology). The next day, the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit/mouse secondary antibodies (#7074/#7076, Cell Signaling Technology). After 1 h at RT, the band intensities were quantified and analysed with Quantity One 1 image analysis software (Bio-Rad).

In vitro coimmunoprecipitation (co-IP) assay

In vitro co-IP assays were performed in PBS in a total volume of 200 µl using 10 µl of protein A/G beads combined with IgG or an anti-PORCN antibody. Each reaction contained 1 µg of GST-tagged Ku70 protein (H00002547-P01, Abnova) and 1 µg of recombinant PORCN protein (CSB-CF887958HU(A4), Cusabio). Binding reactions were incubated at 4 °C for 2 h with rotation. The beads were then washed extensively in PBS. The proteins were then eluted with SDS loading buffer and analysed by Western blot.

Click-iT chemistry assay

Cells were incubated with 50 µM click-iT palmitic acid-azide (C10265, Thermo Scientific) at 37 °C in 5% CO2 for 8 h, washed three times with PBS and lysed with lysis buffer (1% sodium dodecyl sulphate in 50 mM Tris-HCl, pH 8.0). The protein samples were allowed to react with biotin-alkyne using the Click-iT Protein Reaction Buffer Kit (C10276, Thermo Scientific). The biotin alkyne-azide-palmitic protein complex was then pulled down by streptavidin, and the pellets were treated with 1 M hydroxylamine (HAM) in 1% Triton X-100 (pH 7.2) for 1 h at room temperature and then subjected to immunoblotting.

Acyl-biotin exchange (ABE) palmitoylation assay

To irreversibly block unmodified thiol groups, cells were lysed in the presence of N-ethylmaleimide (NEM) in lysis buffer (100 mM NEM, 1% Triton X-100, 1x protease inhibitor cocktail, 1 mM phenylmethanesulfonylfluoride). The lysates were then immunoprecipitated with an anti-Ku70 antibody. G-Sepharose (IP05, Millipore)-coupled precipitates were then incubated with HAM buffer (1 h, RT, LB pH 7.2, 1 M HAM) for specific cleavage and unmasking of the palmitoylated cysteine thiol group. Thereafter, the beads were gently washed with lysis buffer (pH 6.2) and incubated in biotin-BMCC buffer (LB pH 6.2, 1 µM biotin-BMCC, 1 h, 4 °C) for selective labelling of the palmitoylated cysteines. The beads were finally resuspended in 90 µl of nonreducing SDS-PAGE sample buffer; then SDS-PAGE and Western blot with anti-streptavidin-HRP were performed.

Three-dimensional structural model of Ku70

The amino acid sequence of human KU70 was obtained from the UniProt database (ID: P12956). However, since a complete crystal structure for KU70 was unavailable, we utilized ALPHAFOLD2 AI homology modelling software to create a three-dimensional structural model of Ku70. The validity of the model structure was then evaluated using tools such as PROCHECK, which revealed that the essential amino acids were present within reliable structural intervals (favourable and accessible region > 98%).

The xenograft model

Animal procedures were approved by the Ethics Committee of the Tianjin Medical University Cancer Institute and Hospital. Female Nu/Nu mice (6 weeks old, 16–18 g) were used for xenograft experiments. The mice were randomized into six groups (6 or 8/group). Isogenic HT1080 cells and control (1 × 106 in 0.2 ml normal saline) were injected subcutaneously into the right thigh of mice. When the average tumour volume reached 200 mm3, the xenografts were irradiated with 0–10 Gy with shielding of the surrounding areas. Tumour size was measured in two dimensions every 3 days for 33 days.

Statistical analysis

The Statistical Product and Service Solutions 18.0 software package (IBM Corporation, Armonk, NY, USA) was used for statistical analyses. Two-way ANOVA or Student’s t test was used to calculate the significance of the differences between the control and treatment groups. *p < 0.05, **p < 0.01, and ***p < 0.001.