Reagents

PBA2 was synthesized by PharmaBlock Sciences (Nanjing), Inc, and its purity is more than 99% (Fig. 1a). PBA2 was dissolved in DMSO to prepare a stock solution (10 mM) and it was diluted with the cell culture medium to the desired concentration in different experiments. Imatinib mesylate was obtained from Selleck Chemicals (Shanghai) (Fig. 1b). MTS was purchased from MACKLIN (Shanghai) and dissolved in PBS, followed by filtration with a 0.22 μm filter to produce the sterile MTS solution.

Cell culture

The human CML cell line K562 was purchased from the American Type Culture Collection (ATCC) (Manassas, VA, USA) and the murine 32D myeloid cells stably expressing either wild-type (32D-WT) or T315I-mutated BCR-ABL (32D-T315I) was a kind gift provided by Professor Pan JX (Sun Yat-sen University Ophthalmic Hospital, Guangzhou). BCR- ABL expression in these cells was routinely confirmed by Western blot. HEK293T cell line was purchased from ATCC and cultured in Dulbecco’s Modified Eagle Medium (DMEM) medium containing 10% FBS, 100U/ml penicillin, and 100U/ml streptomycin. CML cells were maintained in RPMI 1640 medium supplemented with 10% FBS, 100U/ml penicillin, and 100U/ml streptomycin in the humidified incubator containing 5% CO2 at 37 °C. Additionally, the 32D-WT and 32D-T315I cells were supplemented with 0.5 ng/ml WNT3a to imitate the cellular feature of activated Wnt signaling in CML cells.

NBT assay

After incubation with PBA2 or imatinib, K562, 32D-WT, and 32D-T315I cells were cultured in 96-well plates for 72 h. The nitroblue tetrazolium (NBT) reduction assay was conducted as previously described [20].

SA-β-Gal staining

The senescence-associated β-galactosidase (SA-β-Gal) activity was measured by the Senescence β-Galactosidase Staining Kit (Beyotime Biotechnology, China). SA-β-Gal staining was performed according to the protocol of the manufacturer. Senescent cells were identified as blue-stained cells under an Olympus IX71S8F inverted microscope.

Cytotoxicity assay

The cytotoxic effect of PBA2 and imatinib on CML cells expressing wild-type or T315I-mutated BCR-ABL was evaluated by MTS assay. Approximately 10,000 cells were seeded into the round-bottom 96-well plates, followed by treatment with the indicated concentrations of PBA2 or imatinib for 48 h. After that, 20 µl MTS was added into each well and incubated at 37 ℃ for 3–4 h. Finally, the OD values were detected at 490 nm. The cell viability was calculated using the formula: (Experimental group OD-Blank group OD) / (Control group OD-Blank group OD) × 100%.

Cell proliferation assay

To test the effect of CBP knockdown on cell proliferation, 1000 cells expressing shRNA were seeded into the round-bottom 96-well plates. The 20 µl MTS solution was added into each well and OD values were detected at 490 nm every 24 h. The curves of cell proliferation were drawn using GraphPad Prism.

RNAi

The different shRNA sequences were separately inserted into pLKO.1-eGFP-puro plasmid using T4 DNA ligase. These plasmid vectors were co-transfected with psPAX2 and pMD2.G into HEK293T cells for 48 h to produce lentiviral particles using the Neofect DNA transfection agent (NEOFECT, Beijing). The viral supernatants were collected using 0.45 μm filters before transfecting target cells with 10 µg/ml polybrene. After 24 h, the viral supernatants were removed and the fresh complete culture medium was added. Then the transfected cells were subjected to puromycin selection (1–2 µg/ml) to generate cells stably expressing indicated shRNA. The RNA interference efficiency was confirmed by qRT-PCR and Western blot.

The shRNA sequences are as follows:

CREBBP (human).

shRNA1 (5’- GCTATCAGAATAGGTATCATT-3’),

shRNA2 (5’-GCGTTTACATAAACAAGGCAT-3’),

shRNA3 (5’- ATCGCCACGTCCCTTAGTAAC-3’),

Crebbp (mouse).

shRNA1 (5’- CGCGAATGACAACACAGATTT-3’),

shRNA2 (5’- TAACTCTGGCCATAGCTTAAT-3’),

shRNA3 (5’- GAGGATCATTAACGACTATAA-3’).

qRT-PCR

The qRT-PCR assay was performed according to the manufacturer’s instructions. The total RNA from cells was extracted using the EZB RNA Purification Kit (EZBioscience). Then, the extracted RNA was converted into cDNA through reverse transcription assay using the Color Reverse Transcription Kit (EZBioscience). The obtained cDNA templates were mixed with primers and 2× SYBR Master Mix (EZBioscience). Finally, the PCR amplification reaction was conducted with the ROCHE 480 instrument. Primer sequences are as follows:

CREBBP (F: CACAGAACCAGTTCCCGTCA, R: GGGTTAGGAAGAGCAGCACC)

GAPDH (F: TTCTTTTGCGTCGCCAGCC, R: TCCCGTTCTCAGCCTTGACG)

Crebbp (F: GCCCATTGTGCATCTTCACG, R: GGCTGGTTCATGTAGGGGAG)

Gapdh (F: TGTCAAGCTCATTTCCTGGTATG, R: TTATGGGGGTCTGGGATGGA)

Western blot

The cells were lysed in radioimmunoprecipitation assay (RIPA) lysis buffer supplemented with phenylmethanesulfonyl fluoride (PMSF, 1 mM). Equal amounts of the whole cell lysate were separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes, blocked with 5% skimmed milk at room temperature for 1 h and incubated with primary antibodies overnight at 4 °C. After the incubation of secondary antibodies, the protein bands were detected using the enhanced chemiluminescence (ECL) HRP substrate and visualized using Kodak X-AR film. Antibodies against phosphorylated BCR-ABL, BCR-ABL, phosphorylated GSK3β, GSK3β, β-catenin, p53, p21, and cyclinD1 were from Cell Signaling Technology (Danvers, USA). CBP, p300, JUN, phosphorylated PI3K, PI3K, phosphorylated AKT, and AKT were purchased from Santa Cruz Biotechnology Inc (Paso Robles, CA, USA). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody was from KangCheng Biotech Inc (Shanghai, China).

Co-immunoprecipitation (IP) assay

Total cell lysates were prepared in the ice-cold IP lysis buffer. The supernatant of cell lysate was precleared by Protein G Plus/Protein A-agarose beads to reduce nonspecific binding. Then, either mouse IgG or anti-β-catenin antibody was added to the supernatant and incubated at 4 °C overnight. The bound proteins were washed three times with lysis buffer and dissociated with the beads via boiling and centrifugation. The immunoprecipitated proteins were then analyzed by standard western blot.

In vivo tumor xenograft models

All mouse experiments were conducted with the permission of the Institutional Animal Care and Use Committee (IACUC) of Sun Yat-Sen University Cancer Center (No. L102012015120F). Female BALB/c nude mice were purchased from Gempharmatech-GD (Guangdong, China). To detect the antitumor effect of PBA2, 1 × 107 cells of K562, 32D-WT, and 32D-T315I cells were subcutaneously implanted into the left flank of BALB/c nude mice separately. Mice bearing CML tumor xenografts (approximately 100 mm3) were treated once daily by oral gavage with vehicle, imatinib (100 mg/kg) or PBA2 (at indicated concentrations) for 10 consecutive days. Tumor volume was calculated using the formula: L×W2 × 0.5 (L and W indicate the length and width of tumors, respectively).

Mice survival models

32D-WT or T315I cells were injected into the tail vein of BALB/c nude mice. At 72 h after tumor cells injection, mice were treated once daily by oral gavage with vehicle, imatinib (100 mg/kg) or PBA2 (9 mg/kg) for up to 25 days. Moribund animals were sacrificed as per IACUC guidelines. On necropsy, the mice had marked splenomegaly due to tumor cell infiltration.

Statistical analysis

All experiments were repeated at least three times and the data are presented as mean ± SD or mean ± SEM. The data was compared using One-Way ANOVA or unpaired two-tailed Student’s t-test. Kaplan-Meier survival curves were used to estimate cumulative survival probabilities with a Log-rank test. The GraphPad Prism software was used for statistical analyses. A value of p < 0.05 was considered statistically significant.