Microarray data acquisition

The Cancer Genome Atlas (TCGA) database (Weinstein et al. 2013) was employed to analyze the 385 patients with colonic carcinoma, including follow-up time, age, sex, T stage, lymphatic invasion, distant metastasis and clinical stage. A total of 359 patients who were followed up for ≥ 30 days were included in the analysis. TCGA colon cancer database, containing 480 colon tumor tissue samples and 41 samples from normal colon tissues, was used for the study. The tumor sequences of other 32 in TCGA database were also added to the repository. Differential gene analysis. The “Limma” package was used to analyze NR3C2 differential expression in colon tumor tissue versus normal tissue, and in para-cancerous and cancerous tissues from the same patient. The results were visualized using the “ggpubr” package. Differentially expressed genes were also obtained using this package. This screening identified genes that showed significant alterations in expression levels, highlighting their potential relevance under the specified experimental conditions.

Single-cell expression analysis

The data (GSM7844844) were pre-processed and analyzed to identify different cell populations and their expression profiles. Data processing involved quality control, normalization, and dimensionality reduction using the Seurat package (v3.1.5). The quality control steps included filtering cells with low gene counts and high mitochondrial gene content. Normalized data were used for clustering analysis to identify distinct cell populations. Visualization of the data was achieved using t-SNE and UMAP plots, and cell type annotation was performed based on known marker genes from literature and databases such as CellMarker and PanglaoDB.

Cell communication analysis

Cell communication analysis was performed using the CellChat package (v1.0.0). The normalized expression data from the scRNA-seq dataset (GEO accession number: GSM7844844) were used to construct cell communication networks. The ligand-receptor interactions were identified using the built-in database in CellChat. We calculated the communication probability and strength between different cell types. Major signaling pathways and communication patterns were analyzed and visualized using heatmaps and network plots. This analysis revealed the complex interactions within the tumor microenvironment, providing insights into the cellular crosstalk.

Cell lines and culture conditions

For the purpose of colon cancer investigation, RKO (human colon adenocarcinoma cell line) tumor cell were used. Cultivated in a high-glucose DMEM medium from Thermo Fisher Scientific, the cells were nourished with a 10% fetal bovine serum (FBS) mixture along with a cocktail of antibiotics. Both procured from the Beyotime Institute of Biotechnology, along with 2.5 ng/ml amphotericin B from Sangon Biotech Co., Ltd.

Oligonucleotide transfection

RKO cells were transfected with the Lipofectamine™3000 (Invitrogen). Sequences of NR3C2 shRNA were as follows: CCGG‐CCAGCTAAGATTTATCAGAAT‐CTCGAG‐ATTCTGATAAATCTTAGCTGG‐TTTTTT. Following the protocol provided by the manufacturer. The cells were spread at a concentration of 100,000 cells per well in 6-well plates in a 37 °C incubator with a 5% CO2 environment. The transfection process was conducted for 48 h at 37 °C. Western blot techniques were employed to assess the effectiveness of the shRNA in silencing NR3C2. For NR3C2 overexpression, NR3C2 pLV (Exp)-EGFP: T2A: Hgyro-EF1A was used (Cyagen Biosciences, Inc.). Cells with stable expression of NR3C2 were generated by transfecting them with the NR3C2-containing retroviruses. Puromycin or hygromycin (Sangon Biotech Co., Ltd.) was added to the cell cultures for selecting stable cells at 4 μg/ml, while 1 μg/ml puromycin or hygromycin was employed to maintain a stable cell culture. Cells transfected with viruses containing empty vectors served as controls.

Tissue collection

The tissue collection follows the patient’s informed consent. The ethical approval number associated with this protocol is 2021-SA06. Tissue samples were obtained via surgery, including both tumor tissues and para-cancer tissues (5.0 cm away from the tumor margin). Metastasis of cancer cells to distant areas, combined with other malignant tumors, accompanied by other serious systemic diseases, accompanied by Crohn’s disease and other chronic gastrointestinal diseases were excluded.

Cell proliferation assay

Enzymatic activity as an indicator of cell proliferation was measured using the Cell Counting Kit-8 (CCK-8) reagent provided by Dojindo Molecular Technologies, Inc., according to the instructions of the manufacturer.

Matrigel invasion assay

Cell invasion was evaluated in vitro using Transwell inserts from Corning, Inc., which feature an 8-µm pore size. The inserts were pre-coated with 30 μl of a 1:9 dilution of Matrigel. A suspension of 3 × 104 cells in 200 μl of culture medium was placed into the upper chamber. The cells were allowed to invade the Matrigel and move towards the lower chamber, which from Sigma-Aldrich and Merck KGaA. Following a 24-h incubation period, the cells that had migrated were fixed. The number of invasive cells was quantified under a Nikon Corporation light microscope by examining three randomly selected high-magnification fields.

Xenograft experiments

This study’s xenograft experiments were granted approval by The People’s Hospital of Yubei District, Chongqing, with the ethical approval number 2021-SA06. Operate in the animal room of the hospital, all operations comply with animal welfare principles. For the study, six-week-old nude mice, sourced from Shanghai, China, were selected. The experiment involved 20 mice, evenly divided between males and females, with an average weight of 18–20 g. They were kept under standard environmental with food and water provided as needed.In the xenograft procedure, RKO cells suspended in a 0.2 ml in the right flank, ensuring cell viability for tumor development. The injection protocol was uniform across all mice to maintain experimental consistency. Tumor size was measured tri-weekly with calipers for the duration of the study.

Western blotting

Protein was lysed using RIPA and subjected to water bath denaturation. During electrophoresis, 50ug of protein solution was added to each lane for electrophoresis. After electrophoresis, the membrane was transferred and blocked with BSA. Then, the primary antibody was incubated as follows. For immunoblotting, a panel of specific primary antibodies was used, purchased from Abcam and Novus Biologicals (NB) and Cell Signaling Technology (CST), including anti-NR3C2 (1:1000, Abcam, cat.no.ab2774), anti-β-catenin (1:2000, CST, cat.no.8480), anti-c-Myc (1:2000, CST, cat.no.5605), anti-cyclin D1 (1:1000, Abcam, cat.no.ab16663), anti-cleaved-caspase 3 (1:1000, CST, cat.no.9664), anti-Bcl-2 (1:2000, CST, cat.no.15071), anti-Bax (1:1000, CST, cat.no.5023), anti-LC3 (1:1000, NB, cat.no.NB100-2220), and anti-β-actin (1:2000, CST, cat.no.3700), as a loading control. Incubate with the secondary antibody for exposure.

Statistical analysis

Genetic analysis data were statistically analyzed using the Wilcoxon test in R4.3.2 software. To further explore the correlation between NR3C2 gene expression, the Wilcoxon test or Kruskal–Wallis test was utilized.Cox proportional hazards regression models, both simple and multiple variable, were applied to investigate the interplay between NR3C2 expression levels and a range of clinicopathological factors, focusing on different clinical endpoints. P < 0.05 was considered to indicate a statistically significant difference.