Plasmids and cloning

The 2nd generation VLP backbone plasmid was generated by first inserting unique restriction sites, BlpI and XhoI, into the 1st generation pSIV3 + plasmid [18] using a 3-step standard PCR protocol with 5’ GATGCCCTACAGAATCAGAGAGCAG 3’ (forward) and 5’ CTCGAGGTGGCTAAGCAGTGAGCTATGCCACCTCTCTAG 3’ (reverse) for the first and 5’ GCTCACTGCTTAGCCACCTCGAGATGTACATTTATATTGGCTC 3’ (forward) and 5’ GTAACCATTATAAGCTGCAATAAACAAGTTAACAACAAC 3’ (reverse) for the second PCR reaction. This left the Rev-responsive element (RRE) intact, but the accessory proteins Vif, Vpx, Vpr, Tat, and Rev were removed. Subsequently, 3xFLAG-tagged Vpx/Vpr were inserted using the available BlpI and XhoI cutting sites [14].

SIVmac Vpx mutants were generated from the pSIV3 + 3xFLAG-VpxSIVmac239 construct by Gibson assembly cloning. PCR fragments containing the required amino acid substitutions were replaced using BlpI and XhoI. For the VpxSIVmac239 P64Q mutant, two fragments were generated using 5’-gagaggtggcatagctcactgc-3’ (forward) and 5’-gctcatgccctgctcgtcg-3’ (reverse), and 5’-gtaatgttggacatgagccaatataaatgtacatc -3’ (forward) and 5’-cacgacgagcagggcatgagccagagctacgtgaagtacagatac-3’ (reverse). For VpxSIVmac239 I75M, two fragments were generated using instead a different reverse primer for the second fragment: 5’- cacgacgagcagggcatgagccccagctacgtgaagtacagatacctgtgcctgatgcagaaggccctgttcatg-3’ (reverse). For the VpxSIVmac239 P64Q + I75M double mutant (equivalent to VpxSIVmac251), two fragments were generated with a new reverse primer for the second fragment: 5’- cacgacgagcagggcatgagccagagctacgtgaagtacagatacctgtgcctgatgcagaaggccctgttcatg -3’ (reverse). To generate pSIV3 + VpxSIVmac239 P64Q + I75M without the 3xFLAG-tag, an insert was generated by amplifying VpxSIVmac239 P64Q + I75M and adding overlapping sequences for Gibson assembly with the primers 5’-gagaggtggcatagctcactgc-3’ (forward) and 5’-gagaggtggcatagctcactgcttagccaccatgagcgaccccagagagagaatc-3’ (reverse). All generated plasmids were sequence verified by Sanger sequencing.

Cell culture

HEK293T cells (DSMZ ACC635) were cultivated as described [19]. All AML suspension cell lines were cultivated in Iscove’s modified Dulbecco’s medium (IMDM, Sigma-Aldrich), supplemented with 10% fetal calf serum (FCS, Sigma-Aldrich), 100 units/mL penicillin, and 0.1 mg/mL streptomycin (Sigma-Aldrich). HEL SAMHD1 cells were generated by lentiviral transduction using pHR-SAMHD1 as transfer vector—successful transduction was monitored by intracellular SAMHD1 staining. The generation and cultivation of Ara-C resistant HEL (HEL Ara-Cr) and HL-60 (HL-60 Ara-Cr) cell lines have already been described [6]. The cells were maintained at a density of approximately 1 × 106 cells/mL and incubated at 37 °C and 5% CO2.

Patients

After written informed consent in accordance with the Declaration of Helsinki and approval by the Institutional Review Board of the Ludwig-Maximilians-University (Munich, Germany, reference number: 216-08), bone marrow (BM) samples were collected from patients with AML at primary diagnosis. Patient characteristics are summarized in Supplementary Table 1. Mononuclear cells from AML patients were isolated by density gradient centrifugation (Biochrom, Berlin, Germany) from BM samples and cryoconserved at below −80 °C in 80% FCS and 20% dimethyl sulfoxide (Serva Electrophoresis, Heidelberg, Germany). At diagnosis, a standard analysis of all samples was centrally done at the Laboratory for Leukemia Diagnostics, LMU University Hospital Munich. This included cytomorphology, cytogenetics, fluorescencein situ hybridization, and molecular genetics. For cytogenetic risk assessment refined MRC (medical research council) criteria were used. Combined cytogenetic and molecular risk stratification groups were assigned in accordance with the European LeukemiaNet (ELN) guidelines.

Primary CD4 + T cell isolation and cultivation

The isolation and cultivation of primary CD4 + T cells from healthy donor blood were recently described [19]. The isolated cells were incubated at 37 °C and 5% CO2 in RPMI medium (Thermo Fisher Scientific) containing FCS and penicillin/streptomycin at a cell density of 2 × 106 cells/mL without addition of cytokines.

VLP production

For the production of 2nd generation VLPs, 26.25 µg of 2nd generation pSIV3 + plasmid encoding the appropriate Vpx/Vpr homolog, 3.55 µg of pCMV HIV-1 Rev plasmid, and 7.08 µg of the pMD2.G plasmid encoding the VSV-G envelope protein were used per 145 cm2 dish with 80–90% confluent HEK293T cells, unless otherwise stated. For the 1st generation VLPs, the Rev plasmid was replaced by an empty pcDNA plasmid, and the 1st generation pSIV3 + plasmid was used [6]. For the production of the BlaM-Vpr VLPs, HEK293T cells were transfected with 8.3 µg pCMV plasmid encoding BlaM-Vpr, 12.5 µg psPAX2 packaging vector, and 4.125 µg of pMD2.G plasmid. psPAX2 was a gift from Didier Trono (Addgene plasmid # 12,260; http://n2t.net/addgene:12260). 48–72 h post-transfection, the supernatant was filtered through 0.45 µm vacuum filters, overlaid onto 25% sucrose cushion, and subsequently subjected to ultracentrifugation at 110,000 × g for 2 h at 4 °C. After centrifugation, the supernatant was discarded, the VLPs were reconstituted in PBS for at least 30 min at 4 °C, thoroughly re-suspended, and stored at −80 °C.

SG-PERT

The yield of VLPs was quantified via the SYBR Green I-based real-time PCR-enhanced reverse transcriptase (SG-PERT) assay [20]. Samples were run on the CFX96 BioRad qPCR machine, and results were analyzed using the CFX Maestro Software. The RT activity of the VLPs was determined as pRT units per µL.

Primary CD4 + T cell nucleofection

Prior to subcloning, the efficacy of different FLAG-tagged Vpx/Vpr proteins [14] to degrade SAMDH1 in resting CD4 + T cells was tested. For this purpose, 625 ng FLAG-tagged Vpx/Vpr expression plasmids [14] together with 375 ng pMAX GFP were nucleofected into primary CD4 + T cells using the 4D-Nucleofector® X Kit P3 (Lonza) according to the manufacturer’s recommendations (program EO-115).

VLP titration

For VLP titration assays, 1 × 105 THP-1 cells were distributed into each well of a flat-bottom 96-well plate in 200 µL of final volume. Different volumes of VLPs were added prior to spinoculation at 1200 × g for 90 min at 37 °C. The transduced cells were then incubated at 37 °C and 5% CO2 for 24 h before conducting SAMHD1 staining.

VLP and Ara-C co-treatment

1 × 104 cells per well of AML cell lines at 80 µL final volume were distributed into flat-bottom 96-well plates. 10 µL of VLPs were then added, and spinoculation was performed as described above. After 24 h, 10 µL of 1:4 serial dilutions of Ara-C were added to the VLP-treated cells and incubated for 96 h at 37 °C and 5% CO2. Subsequently, 10 µL of resazurin was added to each well and incubated for a further 5 h. The reduction of the blue dye resazurin to pink resorufin by viable cells was measured using the CLARIOstar Plus microplate reader at the wavelengths 600 nm and 570 nm, respectively. Resazurin reduction of untreated cells was used as control to calculate the percentage viable cells in all treated wells. All ex vivo cytotoxicity assays using AML blasts were performed as published previously [22]. The amount of viable primary AML blasts was determined by flow cytometry (Cytoflex S, Beckman Coulter, Brea, CA, USA). The following fluorochrome conjugated monoclonal antibodies were used (all with 1:50 dilutions): CD45 (HI30), CD33 (WM-53), CD34 (561) (all from BioLegend, San Diego, CA, USA). For dead cell discrimination, LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit (Thermo Fisher Scientific, Waltham, MA, USA) was used. Specific lysis was calculated as follows: % specific lysis = 100 – × 100.

Intracellular staining of SAMHD1 and flow cytometry

The intracellular staining of SAMHD1 was conducted as previously described [19, 21]. Briefly, VLP-treated cells were washed with PBS and stained with Zombie Green/Zombie Violet™ fixable viability dye (Thermo Fisher Scientific, in DMSO, diluted 1:000 in PBS) for 15 min. Next, the cells were fixed using 4% paraformaldehyde, permeabilized with BD Phosflow Perm Buffer III, and stained with primary SAMHD1 antibody (Proteintech), followed by secondary anti-rabbit antibody conjugated to AlexaFluor 660 (Invitrogen). Intracellular SAMHD1 levels were measured using the BD FACSLyric instrument and analyzed using the FlowJo software.

For the SAMHD1 staining of primary AML blasts, the cells were first washed in PBS and transferred to 96-well v-bottom plates. The cells were then stained for surface markers using 1:20 dilutions of the following antibodies: anti-CD33-PE (BioLegend), anti-CD34-FITC (BioLegend), and anti-CD45-V450 (BD). The cells were incubated for 30 min at 4 °C in the dark and washed in FACS stain buffer (PBS, 1% FCS, 0.09% sodium azide, 2 mM EDTA) before being fixed, permeabilized, and stained for SAMHD1 as described above. SAMHD1 levels were determined in CD45 + AML blast cells using the BD FACSLyric instrument and analyzed using the FlowJo software.

For surface staining of primary CD4 + T cells, samples were treated analogously to primary blasts except that anti-hCD4-FITC (Invitrogen) diluted 1:100 in PBS was used instead.

SDS-PAGE and western blot

Total protein from AML cells were extracted as recently described [19]. Briefly, cells were lysed in Hunt lysis buffer via freeze–thaw cycles in liquid nitrogen and centrifuged at top speed at 4 °C for 30 min. The protein-containing supernatant was transferred to a fresh tube. An appropriate volume of total protein was diluted in PBS. 4 × Laemmli buffer was added to the diluted total protein and boiled for 5 min at 95 °C. For SDS-PAGE analysis of VLPs, VLPs were prediluted in PBS before adding 4 × Laemmli buffer. 12% polyacrylamide gels were prepared according to manufacturer’s instructions (Thermo Fischer Scientific, SureCast system). PageRuler Plus Prestained protein ladder (Thermo Fisher Scientific) was used as a ladder. Electrophoresis was performed at constant voltage of 100 V for 1 h, followed by wet transfer of the separated proteins onto a nitrocellulose membrane at 10 V for 1 h. The membranes were blocked using 5% milk in TRIS-buffered saline with 0.1% Tween-20 for 30 min before performing immunoblotting with the appropriate antibodies. Rabbit anti-SAMHD1 (Proteintech, 1:1000), mouse anti-vinculin (Sigma-Aldrich, 1:2000), anti-p27 (hybridoma supernatant, 1:100), and anti-FLAG (Sigma-Aldrich, 1:1000) were used as primary antibodies to detect the respective proteins. Species-specific antibodies conjugated with horseradish peroxidase at 1:10,000 dilution were used as secondary antibody, followed by staining using either the Clarity™ Western ECL Kit (BioRad) or the SuperSignal™ West Femto Maximum Sensitivity Substrate kit (Thermo Fisher Scientific). Membranes were imaged on the Vilber Fusion FX machine.

Automated SDS-PAGE and western blot using protein simple jess system

For the detection of SAMHD1 from low amounts of total protein, the Jess automated SDS-PAGE and western blot system was used as per manufacturer’s instructions. Mouse anti-SAMHD1 (1:200 dilution, customized, kindly provided by Dr. Keppler) and mouse anti-vinculin (1:2000 dilution, Sigma-Aldrich) antibodies were used with the anti-mouse detection module provided by ProteinSimple. For the separation of the proteins, a 13-well 12–230 kDa separation module was chosen.

Virion fusion assay

In order to determine the VSV-G-dependent fusion efficiency, a virion fusion assay was performed [23]. First, 2 × 105 AML cell lines or primary AML blasts were seeded in U-bottom 96-well plates. 1 × 1010 pRTU/µL of BlaM-Vpr VLPs were then added to the cells and spinoculated as described above. The cells were incubated for a further 2.5 h at 37 °C and 5% CO2, pelleted, and the supernatant was aspirated. Cells were stained with CCF4 staining solution (Thermo Fisher Scientific). 1 mL of the staining solution contained 2 µL of the CCF4 dye, 8 µL Solution B (LiveBLAzer™ FRET-B/G Loading Kit, Thermo Fisher Scientific), and 10 µL Probenecid, diluted in CO2-independent medium (Thermo Fisher Scientific) at room temperature in the dark overnight, wrapped in wet tissue to avoid evaporation. The following day, the cells were washed, fixed with 4% paraformaldehyde, and subjected to flow cytometry. A shift in the emission from 520 to 450 nm represents the cleavage of the CCF4 by the BlaM-Vpr fusion protein, indicating successful fusion of the VLP with the target cell.

Ara-CTP measurement

The concentrations of 13C3-Ara-CTP in the samples treated with VLPs were analyzed by liquid chromatography–electrospray ionization-tandem mass spectrometry (LC-MS/MS) essentially as previously described [6]. In brief, 2.5 × 105 THP-1 cells in a 12-well format with 1 ml culture medium/well were treated with 25 µl of purified and concentrated VLPs by centrifugation at 1200 × g for 90 min at 37 °C. After 20 h, the cells were treated with 10 µM 13C3-Ara-C for 6 h, harvested, washed once with PBS, and subjected to LC-MS/MS measurement.

In silico structural predictions

Structural predictions of SIV mac239 Vpx, SIV mac239 VpxP64Q, SIV mac239 VpxI75M, and the double mutant equivalent to SIV mac251 Vpx were generated using AlphaFold [24, 25]. Here, the user interface ChimeraX was used [26, 27] with the preinstalled AlphaFold structure prediction tool using ColabFold software coupled to Google Colaboratory [28].

Statistical analysis

Statistical analyses were carried out with Prism 9 (GraphPad). Data are visualized as the mean and the standard error of the mean (S.E.M). See figure legends for the statistical test applied in each case. Cell viability curves were modeled using a nonlinear fit in Prism 9 (Absolute IC50, X is concentration, baseline constraint set to 0).