Cells culture

Mouse ADSCs (MUBMD-01001) were obtained from Ori Cell Bio Co., Ltd. The mADSCs was cultured in mADSC complete culture medium (Ori Cell Bio, MUXMD-90,011). mADSCs were cultivated at 37 °C in an incubator with 5% CO2 and 95% air. The studies were conducted using mADSCs during the fourth passage.

Raw264.7 (CL-0190) and HUVECs (CL-0122) were obtained from Procell Life Science & Technology Co., Ltd. We cultured the cells in an incubator in 5% CO2 and 95% air at 37 °C. DMEM (Gibco, C11995500BT) supplemented with sterile 10% FBS (Gibco, 10,099,141 C) and 1% penicillin‒streptomycin (Gibco, 1,719,675) was used to culture the cells.

Add the cell suspension (100 µl/well, 1000 cells/well) to the 96U-shaped well plate (Engineering For Life, EFL-SP101) of the cell pellet treated with the anti-adhesion coating solution. Spherical 3D-mADSCs were formed after 48 h of culture in the plate, and the next experiment was carried out. Optical microscope was used to observe the status of 2D-mADSC and 3D-mADSC. The cytoskeleton was labeled with phalloidin-FITC (Actin-Tracker Green; Beyotime, C1033), and the nucleus was stained with DAPI (Abcam, ab228549). The Calcein/PI cell viability and cytotoxicity detection kit (C2015S) were employed, following the manufacturer’s instructions, to stain 2D- and 3D-mADSCs, for the purpose of observing cell viability. And the cell morphology of 2D- and 3D-mADSCs was observed under a confocal microscope.

Animals

The Wenzhou Medical University Animal Welfare and Use Committee approved each animal test that was carried out in accordance with the China National Institutes of Health’s Guidelines for the Welfare and Use of Lab Animals (wydw2024-0057). Male C57BL/6 mice (mean body weight 20–30 g, 6–8 weeks) were provided by the Wenzhou Medical University Experiment Animal Center (no. SCXK [ZJ] 2015–0001). All mice were kept under normal conditions (21–25 °C, humidity: 50–60%, 12-h light/dark period) and possessed free food and beverages. Every mouse utilized in this research has a background in C57BL/6J.

Isolation and characterization of ABs

After being treated with 0.5 µmol/L STS (Med Chem Express, HY-15,141) for apoptosis induction, 2D or 3D-mADSCs were incubated at 37 °C in 5% CO2. Cell supernatants were collected after 12 h and centrifuged for 5 min at 300 × g to eliminate any remaining cell debris. After that, the supernatants were centrifuged three times for 30 min at 2,000 × g. ABs derived from 2D or 3D-mADSCs were then resuspended in PBS (Procell, PB180327) for further use. To ascertain the protein composition of 2D or 3D-ABs, we employed the BCA protein assay. Utilize a scanning electron microscope (SEM) to examine the morphology and estimate the size range of the isolated ABs. The accurate size distribution of 2D or 3D-ABs (gated size with mouse platelets) was measured using flow cytometry. Western blotting (WB) experiments was conducted to identify ABs using surface marker proteins (H3(Protein Technology Group, 17168-1-AP), H2B (ABclonal, A1958), C1QC (ABclonal, A9227) and C3B (ABclonal, A13283)). The WB experimental method used here is as previously described in a referenced article [12]. β-Actin (Abcam, ab213262) was employed as a quantitative indicator in WB. In accordance with the manufacturer’s instructions, 2D- and 3D- ABs were stained with the Annexin V-FITC/PI Cell Apoptosis Detection Kit (Servicebio, G1511) to identify unique PS signs on the ABs. FCM was employed to evaluate the purity of the ABs.

Internalization of ABs into HUVECs and Raw264.7 in vitro

After plating the HUVECs and Raw264.7 onto plates, they were kept at 37 °C for the whole night. 2D or 3D-ABs were pre-labeled with the Cell Plasma Membrane Staining Kit with DiI (Beyotime, C1991S) as directed by the manufacturer and centrifuged three times at 2,000 × g for 30 min in PBS. DiI 2D or 3D-ABs were then co-cultured with HUVECs for 12 h at a concentration of 10 µg/ml. After the cell nuclei were fixed for 15 min at 4 °C with 4% paraformaldehyde (Solarbio, P1110), they were counterstained with Hoechst 33,342 (Biosharp Life sciences, BL803A). Cell morphology of HUVECs and Raw264.7 with DiI-ABs (2D and 3D) was observed under a confocal microscope.

Hypoxic cell model

Cells were chosen from a healthy logarithmic growth phase, trypsined with 0.25% (Gibco, 25,200,072), followed by centrifugation, supernatant removal, resuspension, and subsequent seeding in cell culture plates for the respective experiments. The normoxic group was cultured in a standard cell culture incubator. The hypoxia group and drug administration group were incubated in a humidified hypoxic chamber at 37 °C, with an atmosphere (1% O2, 5% CO2, and 94% N2) for 24 h.

Cell counting kit 8

HUVECs were plated in 96-well plates at a density of 5 × 103 cells per well, resulting in 50% cell confluence. The cells were then exposed to a variety of therapies, including PBS, 2D-ABs at different concentrations (ranging from 0 to 70 µg/ml), and a 10 µg/ml concentration of 2D/3D-ABs. The cells were co-incubated with gradient ABs concentrations in 96-well plates within a hypoxic incubator. In contrast, NC group cells were cultured in 96-well plates in a normoxic incubator, following the procedure outlined in the “Hypoxic cell model”. Subsequently, 10 µL of CCK-8 solution (Med Chem Express, HY-K0301) was introduced to the wells, and the cells were incubated at 37 °C for 3 h. A microplate reader was used to measure absorbance at 450 nm.

Tube formation assay

On ibidi µ-slides (Ibidi, 81,506) covered with 10 µL/well of growth factor-reduced Matrigel (Corning, 356,234), the in vitro angiogenic activity of HUVECs was evaluated. HUVECs were reseeded in the prepared ibidi µ-slides after being stained for 30 min with the cell-permeable dye (calcein AM; Beyotime, C2012). Using a confocal microscope, capillary-like tube development was seen during an 8-hour incubation period at 37 °C in a cell culture incubator. These structures were defined as tubes with a length four times their width. Tube lengths were quantified in duplicate wells, and the average length was calculated using ImageJ software.

Transwell assay

Polycarbonate membrane Transwell inserts (8.0-µm) were used in cell migration tests to evaluate the in vitro migratory ability of HUVECs in each group (Corning, 3422). HUVECs were positioned in the top chambers and cultured at 37 °C for eight hours following the prescribed procedures. Subsequently, crystal violet staining and 4% paraformaldehyde fixation were applied to each chamber’s cells. A computerized microscope was used to take pictures of the migrated cells.

Apoptosis detection

The Annexin V-FITC/PI Cell Apoptosis Detection Kit was used to stain the HUVECs in each group in compliance with the guidelines given. The apoptosis levels of HUVECs were subsequently detected using flow cytometry.

Immunocytochemistry

HUVECs in each group were subjected to fixation for 30 min with 4% paraformaldehyde. Subsequently, they underwent a 5-minute permeabilization step using 0.1% Triton X-100 (Aladdin, T109027) in PBS, followed by a 30-minute blocking procedure with 10% goat serum (Beyotime, C0265) in PBS. Intracellular ROS levels in HUVECs were assessed using DHE (Dihydroethidium; Beyotime Biotechnology, S0063) following the manufacturer’s protocol. Dead cell levels in HUVECs were determined through TUNEL (In Situ Cell Death Detection Kit, Fluorescein; Roche, 11,684,795,910) according to the manufacturer’s instructions. JC-1 (Beyotime Biotechnology, C2003S) was used to measure the mitochondrial membrane potential in HUVECs as per the manufacturer’s guidelines.

Macrophage polarization assay

Raw264.7 cells from different stimulation groups were trypsined, resuspended, and chilled at 4 °C, followed by fixation in 70% alcohol for 2 h. After two resuspensions in PBS and adjustment to a concentration of 2 × 106 cells per EP tube, antibodies were developed in the cells: Arg1 (1:50; Cell signaling Technology, 93,668 S) and iNOS (1:50; Cell signaling Technology, 13,120 S) for 30 min. Subsequently, they were resuspended twice in PBS, treated with secondary antibodies (goat anti-rabbit IgG - H&L DyLight® 488 (Abcam, ab96883); goat anti-mouse IgG - H&L DyLight® 594 (Abcam, ab96873)), and then washed twice with PBS prior to conducting flow cytometry analysis.\ qPCR.

Using the mirVana miRNA Isolation Kit (Ambion) and the manufacturer’s instructions, total RNA was extracted. Total RNA was quantified using the Nanodrop 2000 (Thermo Fisher Scientific Inc., USA). The Agilent 2100 Bioanalyzer (Agilent Technology, USA) was utilized to evaluate the integrity of RNA.

Quantitation was completed via a two-step reaction: reverse transcription (RT) and PCR. Every RT process involved 0.5 µg of RNA, 2 µL of 5 × TransScript All-in-One SuperMix for qPCR and 0.5 µL of gDNA Remover (10 µL). The reaction was performed using a GeneAmp® PCR System 9700 (Applied Biosystems, USA) for 15 min at 42 °C and then for 5 s at 85 °C. Subsequently, the 10 µL RT reaction mixture was desaturated 10 times at -20 °C in nuclease-free water. Real-time PCR was performed using a Light Cycler® 480 II real-time PCR instrument (Roche, Switzerland) with 10 µL of PCR mix, 1 µL of cDNA, 5 µL of 2 × PerfectStart Green qPCR SuperMix (TransGen Biotech Co., AQ601), 0.2 µL of forward primer, 0.2 µL of reverse primer and 3.6 µL of nuclease-free water. The reaction was performed in a 384-well optic plate for 0.5 min (Roche, 04729749001) at 94 °C and then for 45 cycles of 5 s at 94 °C and 30 s at 60 °C. The specimens were analysed three times. After the PCR cycles were complete, a melting curve assay was used to verify the production of the anticipated PCR products. The following primer sequences were synthesized by GeneChem using the mRNA sequences acquired from the NCBI database: Tnf 5’- GATCGGTCCCCAAAGGGATG − 3’ (forward) and 5’- CCACTTGGTGGTTTGTGAGTG − 3’ (reverse); Nos2 5’- TCTAGTGAAGCAAAGCCCAACA − 3’ (forward) and 5’- CCTCACATACTGTGGACGGG − 3’ (reverse); Il6 5’- CCTTCTCCACAAGCGCCTTC − 3’ (forward) and 5’- GGAAGGCAGCAGGCAACA − 3’ (reverse); Cd163 5’- GTGCTGGATCTCCTGGTTGT − 3’ (forward) and 5’- CGTTAGTGACAGCAGAGGCA − 3’ (reverse); Arg1 5’- GTAGACCCTGGGGAACACTAT − 3’ (forward) and 5’- ATCACCTTGCCAATCCCCAG − 3’ (reverse); Il10 5’- GCTGTCATCGATTTCTCCCCT − 3’ (forward) and 5’- GACACCTTGGTCTTGGAGCTTAT − 3’ (reverse); Actb 5’- CTACCTCATGAAGATCCTCACCGA − 3’ (forward) and 5’- TTCTCCTTAATGTCACGCACGATT − 3’ (reverse). We normalized the expression of the target mRNAs to Actb mRNA expression, respectively. The 2-ΔΔCt method was used for qPCR analyses.

Western blotting

Using cold RIPA lysis buffer (Beyotime, P0013B) enhanced with phenylmethanesulfonyl fluoride (PMSF; Beyotime, ST506) as well as a protease and phosphatase inhibitor cocktail (Beyotime, P1046), Raw364.7 cell samples were homogenized. To obtain cell lysate, the homogenates were centrifuged at 20,000 g for 30 min at 4 °C. The Omni-EasyTM Instant BCA Protein Assay Kit was used to measure the protein concentrations.After loading 30 mcg of protein onto 4–22% SDS–PAGE gels, the protein was subsequently moved into PVDF membranes (Millipore). When primary antibodies were applied, the PVDF membranes had been diluted using 5% skim milk (BD Biosciences, 232,100) and incubated at 4 °C for 15 h. The membranes followed by treatment with HRP-conjugated secondary antibodies at room temperature for 1.5 h. An Omni-ECL Pico Light Chemiluminescence Kit (EpiZyme, SQ201) was utilized to identify protein bands, as well as a ChemiDoc system (Bio-Rad) was employed to display the results. Using Image Lab software from Bio-Rad, bands were analyzed. The following proteins were targeted by the main antibodies (1:1,000) in the study: iNOS (Cell Signaling Technology, cat# 13,120 S), Arg1 (Cell Signaling Technology, cat# 93,668 S) and β-actin (Abcam, cat# ab213262).

Random-pattern skin flap model

Mouse random-pattern skin flap model was done as previously described [12]. The C57BL/6 mice were anesthetized via intraperitoneal injection with a 1% (w/v) solution of sodium pentobarbital. Afterward, using an electric shaver and depilatory cream, the fur from the back of the anesthetized model mouse with a randomly-pattern flap was shaved. Under sterile conditions, sterile instruments were used to lift the caudal skin/sarcoma flap (dimensions: 1.5 × 4.5 cm2) under the dorsal fascia of the mouse. Subsequently, the sacral arteries that provided blood supply to the flap were surgically excised, including both the left and right sides. The mice in the PBS group, 2D-ABs group, and 3D-ABs group received subcutaneous injections of 100 µl (administered at 8 injection sites) containing PBS and ABs (at concentrations of 0.5, 1, or 1.5 mg/ml) using a microinjection needle along the immediate extension axis. At last, 4 − 0 nonabsorbable silk sutures were used to sew the split flap straight into the donor bed. To prevent postoperative infection, eliminate the odor of blood from the wound, and deter any biting, the wound was disinfected with 1% iodophor twice daily following the surgery.

We randomly classified the C57BL/6J mice into 7 treatment groups (mg/ml): the PBS (n = 6), 0.5-2DABs (n = 6), 1-2DABs (n = 6), 1.5-2DABs (n = 6), 0.5-3DABs (n = 6), DiI-2D-ABs (n = 5) and DiI-3D-ABs (n = 5) groups. All mice were tagged with ear tags and placed randomly, with five mice per cage, maintained under suitable temperature and humidity conditions with access to ample food and water. The skin flap was evenly divided into three zones, from proximal to distal, namely zone I, zone II, and zone III. Zone II is where our subsequent experimental was performed.

Internalization of ABs into ECs and microphages in vivo

Following the method mentioned above, 0.5 mg/ml DiI-ABs were employed for in situ injection into the skin flap on POD3, a zone II skin flap was obtained for frozen section staining. ECs and macrophages were identified using CD31 (Servicebio, GB11063-2-100) and CD68(Santa Cruz Biotechnology, sc-20,060), respectively. Primary antibodies were left to incubate overnight in a refrigerator set at 4 °C. The subsequent day, after being washed thrice with PBS, secondary antibodies (goat anti-rabbit IgG - H&L DyLight® 488; goat anti-mouse IgG - H&L DyLight® 594) were added, and the samples were incubated for one hour at 37 °C in a water bath. DAPI was used to stain the cell nuclei, and the observation of ABs’ phagocytosis by endothelial cells and macrophages within the flap was conducted using a confocal microscope.

Infrared thermal imaging scan

Thermal images of the ischaemic flaps were captured using the FLIR One Pro (FLIR Systems, Inc. USA) external probe for infrared thermal imaging via a mobile phone. Average temperatures of the operating area and the head and neck area were measured independently (normal skin). Delta-T, defined as the temperature difference between the operating area and normal skin, was determined. Temperature differences between the groups were analyzed and compared. The basal body temperatures of mice in each group remained within the normal range. A closer approach to a delta-T of 0 °C indicated better flap recovery.

Laser doppler blood flow (LBDF)

The vascular network of the flap was visualized using LDBF analysis. After anesthesia on POD7, the mouse was maintained in a disturbance-free environment. Subsequently, a laser Doppler instrument was employed to evaluate the skin flap’s blood supply. The LDBF analysis was conducted following established procedures. The moorLDI Review software (ver. 6.1; Moor Instruments) was utilized to calculate perfusion units (PUs) for the assessment of blood flow. Three measurements of each mouse’s blood flow were made, and statistical analysis was performed on the average result.

Immunohistochemistry

The mouse flap tissue in zone II was fixed using 4% paraformaldehyde. After paraffin embedding, the flap tissue from area II was sectioned into 4-µm sections. In every IF experiment, xylene was used to deparaffinize the sections. After the tissue had been deparaffinized, it was rehydrated and put through a sodium citrate buffer antigen retrieval procedure. Following this, in PBS containing 0.1% Triton X-100, 10% goat serum was used to block the sections. After that, they were incubated for one hour the next day at room temperature with secondary antibodies and throughout the entire night with primary antibodies at 4 °C. DAPI was used to stain the cell nuclei. The primary antibodies utilized were specific to CD31 (1:200), CD68 (1:200), α-SMA (1:200; Proteintech, 67735-1-Ig), iNOS (1:200), and Arg1 (1:200). Goat polyclonal secondary antibody against rabbit IgG - H&L DyLight-488, goat anti-mouse IgG - H&L DyLight-488 (Abcam, ab96871), goat anti-rabbit IgG - H&L DyLight-594 (Abcam, ab96885), and goat anti-mouse IgG - H&L DyLight-594 were among the secondary antibodies.

For TUNEL assays on frozen skin sections, we used an in situ cell death detection kit according to the manufacturer’s instructions. Dihydroethidium (DHE) staining was performed on frozen skin sections as per the manufacturer’s protocol to detect collagen damage. F-CHP (3Helix Inc., FLU300) was applied according to the manufacturer’s protocol.

RNA isolation and library preparation

Total RNA was extracted as previously described. In order to generate small RNA libraries, 1 µg of total RNA from every sample was prepared using the NEBNext Small RNA Library Prep Set for Illumina kit (Cat. No. NEB#E7330S, NEB, USA) in accordance with the instructions provided by the manufacturer. To summarize, both ends of the total RNA were ligated to adapters, and then reverse transcription to cDNA and PCR amplification were performed. Small RNA libraries were produced by isolating and purifying PCR products with a bp range of 140–160. The Agilent Bioanalyzer 2100 system was used to assess the quality of the library.

The Illumina Novaseq 6000 platform was used for sequencing, producing 150 bp paired-end reads. OE Biotech Co., Ltd. conducted small RNA sequencing and analysis (Shanghai, China).

MiR-seq

Base calling was used on the original readings in order to produce sequence data, also known as raw data/reads. Subsequently, low-quality readings were filtered out and reads containing poly (A) and 5’ primer contamination were removed. To acquire clean reads, further filtering was performed on reads from the raw data that did not include a 3’ adapter, insert tag, or that were longer than 41 nt or less than 15 nt. The length distribution of the clean sequences in the reference genome was determined, then the sequences were aligned and subjected to the Bowtie [69] search against Rfam v.10.1 (http://www.sanger.ac.uk/software/Rfam) [70], rRNA, scRNA, Cis-reg, snRNA, tRNA and other RNAs were annotated and filtered. Then, cDNA sequence and Repbase [71] database of species repeat sequence were also identified with Bowtie software. The mature miRNAs were identified by aligning against miRBase v22 database (http://www.mirbase.org/) [72], and the expression patterns in different samples were analyzed.

miRNAs that were differentially expressed were determined and filtered using a threshold of FC > 2 and q value < 0.05. For experiments with biological replicates, the DEG method in the R package was used to determine the q value; for experiments without biological replicates, the Audic Claverie statistic was used. The targets of differentially expressed miRNAs were predicted by using software miranda in animal, with the parameter as follows: S ≥ 150, ΔG ≤ − 30 kcal/mol and demand strict 5’ seed pairing.

R was utilized to conduct GO enrichment and KEGG pathway enrichment analysis of distinct expressed miRNA-target genes, respectively, utilizing the hypergeometric distribution.

Statistics

Statistical assays were completed via the SPSS 22 programme (USA). All data are described as the average ± SEM. All of the data displayed here have undergone normalization to account for unintended sources of variance. To find differences between 3, 4, or 5 groups, an ANOVA was used, followed by LSD (equal variances assumed) post hoc analyses or Dunnett’s T3 (equal variances not assumed). The study employed independent-specimen t tests to ascertain group differences. P < 0.05 indicated statistical significance.