Human peripheral blood and tissue specimens of gastric cancer patients

Peripheral blood and tissue specimens were collected from gastric cancer patients with informed consent at the Department of Surgical Oncology, Affiliated Hospital of Nanjing University of Chinese Medicine. All the patients were pathologically diagnosed with primary gastric adenocarcinoma and did not receive preoperative chemotherapy or radiotherapy. The preoperative peripheral blood specimens were collected. Tumour tissues and corresponding noncancerous mucosa tissues (at least 5 cm from the outer tumour margin) were collected immediately after resection, and snap frozen in liquid nitrogen for further analysis. This study was approved by the Institutional Review Board of Nanjing University of Chinese Medicine and conducted in accordance with the principles of the Declaration of Helsinki.

Isolation and culture of CAFs and normal fibroblasts (NFs)

Isolation and culture of CAFs and normal fibroblasts (NFs) were performed as previously described [9, 10]. In brief, primary CAFs were isolated from gastric carcinoma tissue samples, and primary NFs were isolated from the noncancerous mucosa tissues at least 5 cm from the outer tumour margin in the same patient. Fresh samples were washed with serum-free DMEM, cut into small pieces, and were transferred to a 0.15% collagenase IV solution, followed by incubation at 37 °C for 40 min. Digested cells were filtered through a 40-mm cell strainer (Milex-GP) and centrifuged at 1500 rpm for 10 min. The single-cell suspension was incubated in a Fibroblast Medium Kit (Cat. No. P60108, Innoprot) for 24 h, allowing fibroblasts to attach on culture plates. Unattached cells were removed after 24 h incubation, and the adherent cells were further cultivated for experiments. Cultured CAFs and NFs less than five passages were used for the experiments.

DNA pulldown assay

The DNA pulldown assay was based on the binding ability of desulfobiotin-containing probes with streptavidin beads. When DNA beads are incubated with cellular proteins, DNA-protein complexes are attached to the beads and purified to obtain the associated proteins. DNA probes were synthesised by polymerase chain reaction (PCR) based on the IL-8 promoter sequence (F: 5’-CTATCCGGCCCAAGCTTT-3’; R: 5’-AATAATTCACCTTGGTGTAAC-3’). DNA probes were labelled with Biotin-11-dUTP and were recollected using VAHTS DNA Clean Beads (Vazyme, Nanjing, China). CAFs were collected after trypsin digestion and nucleoproteins were purified using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher, MA, USA). The nuclear protein extract (70 μg) was mixed, and incubated with DNA probes (1 μg) and Bioeast Magnetic Streptavidin (Mag-SA) Beads (Bioeast Mag-SA, Hangzhou, China) (50 μl) at 4 °C for 1 h. Then, the mixtures were centrifuged at 5000×g for 30 s, and the precipitate were washed three times with ice-cold PBS, resuspended in 30 μl of loading buffer, and boiled at 100 °C for 5 min. The collected samples containing the bound proteins were processed by SDS-PAGE for further silver staining and liquid chromatograph mass spectrometer (LC-MS) analysis.

Chromatin Immunoprecipitation (ChIP)

ChIP assays were performed using the SimpleCHIP® Enzymatic Chromatin IP Kit (Cell Signalling Technology, MA, USA) according to the manufacturer’s recommended protocols. Cell lysates of CAFs and AGS (4 × 107 cells) were prepared, and chromatin fragments were fragmented to an average size of 150-900 bp by microcapsule nuclease, and enriched with magnetic beads coated with the antibodies of KDM5B or phosphorylated cAMP responsive element binding protein 1 (p-CREB1) and isotype IgG. Then, the concentrated sample was crosslinked with the input DNA, and the DNA was purified with sodium chloride and protease K. Finally, the specific sequences from immunoprecipitated and input DNA were determined by real-time quantitative PCR (qPCR) for the upstream of IL-8 and SRGN promoter regions. The four primer pairs for the IL-8 and SRGN promoter regions used in qPCR analyses are listed in supplementary Table s1. Pair #3 for IL-8 and pair #2 for SRGN were used for this assay. The qPCR products were processed on 2% agarose gels and visualised on a UV transilluminator.

Immunohistochemistry assay (IHC)

Immunohistochemistry (IHC) assays were performed as per standard protocols. The monoclonal antibodies used were mouse anti-KDM5B (ab244220, Abcam, Cambridge, UK), mouse anti-retinoblastoma 1 (RB1) (anti-RB1) (#9309T, Cell Signalling Technology, MA, USA), rabbit anti-phosphorylated RB1 (anti-pRB1) (#8516 T, Cell Signalling Technology, MA, USA), rabbit anti-SRGN (A6951, Abclone, Wuhan, China), rabbit anti-CD44 (ab189524, Abcam, Cambridge, UK), rabbit anti-CREB1 (#9197, Cell Signalling Technology, MA, USA), and rabbit anti-pCREB1 (ab32096, Abcam, Cambridge, UK).

Multiplex-immunofluorescence (MxIF) and immunofluorescence

Multiplex-immunofluorescence staining was performed following the manufacturer’s recommended protocols using the Opal 7-Colour Automation Detection IHC Kit (NEL811001KT, PerkinElmer, MA, USA). Consecutive staining rounds included α-SMA (#19245, Cell Signalling Technology, MA, USA), MPO (Ab208670, Abcam, Cambridge, UK), CD68 (#76437, Cell Signalling Technology, MA, USA), IL-8 (ab18672, Abcam, Cambridge, UK), CD3 (#85061, Cell Signalling Technology, MA, USA), and pan-CK (#4545, Cell Signalling Technology, MA, USA). Immunofluorescence was performed with α-SMA (#19245, Cell Signalling Technology, MA, USA) and KDM5B (ab244220, Abcam, Cambridge, UK).

Western blotting assay

The expression of the indicated protein was determined by western blotting. The antibodies included mouse anti-KDM5B (ab244220, Abcam, Cambridge, UK), rabbit anti-H3K4me3 (#9751, Cell Signalling Technology, MA, USA), mouse anti-RB1 (#9309 T, Cell Signalling Technology, MA, USA), rabbit anti-pRB1 (#8516 T, Cell Signalling Technology, MA, USA), rabbit anti-SRGN (A6951, Abclone, Wuhan, China), rabbit anti-CD44 (ab189524, Abcam, Cambridge, UK), rabbit anti-CREB1 (#9197, Cell Signalling Technology, MA, USA), rabbit anti-pCREB1 (ab32096, Abcam, Cambridge, UK), rabbit anti-regenerating family member 4 (anti-REG4) (ab255820, Abcam, Cambridge, UK), rabbit anti-SFPQ (ab177149, Abcam, Cambridge, UK), rabbit anti-SAP30 (ab231804, Abcam, Cambridge, UK), and rabbit anti-c-Myc (#18583, Cell Signalling Technology, MA, USA). Relative levels were quantified and normalised to β-actin levels in the same sample using density analysis.

Enzyme-linked Immunosorbent Assay (ELISA)

After treatment with SRGN (MedChemExpress, NJ, USA), GSK467 (MedChemExpress, NJ, USA), or CMs of tumour cells, cell supernatants were collected at the indicated times, and centrifuged for ELISA assay using a human IL-8 ELISA Kit (EH005-96, ExcellBio, China). The assay was performed according to the manufacturer’s instructions. Each experiment was repeated at least thrice.

Cell culture and treatment

The gastric cancer cell lines AGS, HGC27, MKN45, and MKN28, and the human stomach fibroblast line Hs738, were preserved in our group. All cells were authenticated and mycoplasma was negative. All the cells were cultured in DMEM (Invitrogen, Carlsbad, CA, USA) with 10% FBS (Gibco, Grand Island, NY, USA) and 1% penicillin/streptomycin (Thermo Scientific, Waltham, MA, USA) in a humidified incubator at 37 °C with 5% CO2.

Co-culture of neutrophils and tumour cells

Co-culture of neutrophils and tumour cells were performed according to our previous report [14]. Peripheral neutrophils were isolated from the blood samples of healthy donors or patients with gastric cancer using a human peripheral blood neutrophils separation reagent kit (Solarbio, Beijing, China) according to the recommended protocols. The cells were washed with red blood cell lysis buffer (BD Biosciences, NJ, USA), centrifuged, and washed with PBS. For co-culture of neutrophils and tumour cells, in brief, approximately 2 × 105 gastric cancer cells were seeded in the bottom of 6-well plate culturing for 48 hours. Then approximately 3 × 105 neutrophils isolated and purified from healthy donors were seeded in the upper chamber. After co-cultured for 6 hours, neutrophils and corresponding tumour cells were collected for further analysis.

RNA isolation and real-time quantitative PCR (qPCR)

Total RNA was extracted and analysed using qPCR. The relative gene expression was normalised to that of GAPDH. Specific primer sets used for this assay included SRGN (F: 5’-AGGTTATCCTACGCGGAGAG-3’, R: 5’-GTCTTTGGAAAAAGGTCAGTCCT-3’), REG4 (F: 5’-TGAGGAACTGGTCTGATGCCGA-3’, R: 5-’TCCATATCGGCTGGCTTCTCTG-3’) and GAPDH (F: 5’-TTGCCATCAATGACCCCTTCA-3’, R: 5’-CGCCCCACTTGATTTTGGA-3’).

Lentivirus infection

Lentiviruses carrying KDM5B, KDM5BH499Y, RB1, KDM5B short hairpin RNA (shKDM5B), and RB1 short hairpin RNA (shRB1) were constructed by GenePharma Co., Ltd. (Shanghai, China). Transduction was performed according to the manufacturer’s instructions. The shRNAs targeting the sequences for KDM5B were CGAGATGGAATTAACAGTCTT, and CCACATTATTTCTAGTCCAAA for RB1.

Clone formation assay

A total of 800 indicated cells were seeded in 6-well plates, and cultured for approximately 14 d. The cells were fixed with 70% methanol and stained with Giemsa solution. Colonies containing more than 50 cells were considered to be survivors.

Cell invasion assay

The cell invasion assay was performed in a 24-well Transwell Chamber (Costar, Corning, NY, USA) coated with Matrigel (BD Pharmingen, San Jose, CA, USA). The indicated cells (2 × 105/200 μl) were cultured in the upper chamber in serum-free medium with 10% FBS medium in the lower compartment. After incubation at 37 °C for 24 h, the cells were fixed with 4% paraformaldehyde, stained with crystal violet, and then photographed under a microscope.

Wound-healing assay

The indicated cells were seeded and cultured in 6-well plates until a confluent monolayer was formed. A sterile plastic tip was used to scratch the monolayer. Images were taken using a microscope at specified time points to observe the migration distance. Migration was quantified as the percentage of wound closure.

Establishment of subcutaneous allograft tumour model of gastric cancer in Balb/c nude mice

Animal studies were approved by the Animal Management and Use Committee of Nanjing University of Chinese Medicine. Male Balb/c nu/nu mice (SPF, 4 weeks) were purchased from the Institute of Biomedical Sciences, Nanjing University. Sixteen mice were randomly divided into two groups. Approximately 5 × 106 AGS-con or AGS-shKDM5B cells were subcutaneously injected into the nude mice. The mice were euthanized and the tumour tissues were harvested after 3 weeks. Tumour volume was calculated as width × length × (width + length) / 2.

Statistical Analysis

Statistical analysis was performed using the GraphPad Prism software (version 8.0; La Jolla, CA, USA). All values are expressed as the mean ± standard error. Differences between groups were compared using a two-tailed unpaired Student’s t-test or ANOVA for comparison of two or multiple groups, respectively. Categorical variables were assessed using the chi-square test. Overall survival was assayed using the Kaplan-Meier method and the Gehan-Breslow-Wilcoxon test. All experiments were repeated at least three times, and P < 0.05 was considered significant.