Animals

Sixty 8-week-old male spontaneous KKay (type 2 diabetes) mice and 10 C57BL/6 mice (Beijing Huafukang Biotechnology Co., Ltd. (license number: SCXK (Beijing) 2020-0004)), all weighing 18–22 g, were raised in an SPF animal room, and the room temperature, humidity and indoor light/dark alternate time were standard.

KKay mice need High-sugar, high-fat and high-cholesterol feed (KK mice feed 1042). Ingredients: corn, soybean meal, wheat bran, wheat flour, sucrose, fish meal, egg yolk meal, soybean oil, lard, stone powder, dicalcium phosphate, salt, choline chloride, lysine, multivitamin, a variety of mineral elements. Nutritional analysis value: crude protein 17.5%, crude fat 17.9%, crude fiber 3.1%, crude ash 4.5%, moisture 8.5%, Calcium 0.88%, Total Phosphorus, 0.58%, and Nitrogen-free Extract, 48.5%.

MethodsExperimental groups

Fifty-six KKay mice were divided into the DM group (n = 10, raised to 14 weeks of age) and DKD group (n = 46, raised to 20 weeks of age), and C57BL/6 mice were used as the control group (n = 10, raised to 20 weeks of age) randomly. The 56 mice in the DKD groups were divided into the placebo group (n = 10), low dosage (0.3 μg/kg/d) (n = 10), medium dosage (1.4 μg/kg/d) (n = 16), and high dosage (2.5 μg/kg/d) (n = 10) concentration 1,25-(OH)2D3 early intervention groups. The same volume of normal saline and the different concentrations of 1,25-(OH)2D3 were injected daily beginning when KKay mice reached 18 weeks of age for 14 days. Six of the DKD mice were administered 0.12% TMAO at the same time as medium-dose 1,25-(OH)2D3 injection and housed until 20 weeks of age. At the end of the experiment, mice were sacrificed for feces, urine, serum, perirenal adipose tissue and kidney tissue collection for subsequent experiments. This experimental setup was approved by the Laboratory Animal Welfare and Ethics Management Committee of Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences. (Ethics number:SV-20230908-07).

Weight, blood sugar and urine protein measurements

The weights of the mice were measured by a scale. Blood glucose was measured by tail clipping (blood glucose meter was purchased from Sannuo Biosensing Co., Ltd.). Urine samples of mice from each group were collected in metabolic cages, and the urine protein excretion rate, urine microalbumin content and urine creatinine content were detected by electrochemiluminescence method. Urine ACR = urine microalbumin/urine creatinine ratio (unit: mg/g). The urine tests were completed on the automatic biochemical analyzer (Beckman Coulter AU5821) The measurements are listed in Table 1.

Table 1 Differences between control and DKD mice.Serum TNF-α and TMAO content determination

Ocular venous blood was taken and subjected to centrifugation, and serum TNF-α levels was detected by ELISA (R&D Systems, USA, MTA00B) and be read at 450 nm within 30 min. Serum TMAO was detected by LC‒MS assay under chromatographic conditions: ACQUITY UPLC® BEH HILIC Column (2.1 × 100 mm, 1.7 μm, Waters, USA).

Urine tubular injury molecule (KIM-1) and TMAO determination

Sandwich ELISA was used to detect urinary KIM-1 (Abcam, Inc., ab213477) and recoding at the OD at 450 nm. Urine TMAO detection was performed by LC‒MS assay, chromatographic conditions: ACQUITY UPLC® BEH HILIC Column (2.1 × 100 mm, 1.7 μm, Waters, USA).

Perirenal adipose tissue, kidney tissue and fecal specimen collection

Mice were sacrificed by cervical dislocation. The perirenal adipose tissue and kidneys were removed, and suspended in normal saline for later use. Approximately 0.5–1.0 g of feces from between the colon and rectum segments was collected and stored in a sterile cryopreservation tube in a freezer at −80 °C for subsequent experiments.

qPCR

qPCR was used to detect the mRNA expression of TLR4, NF-κB, PGC1α and UCP-1 in kidney tissue. TRIzol was used to extract total RNA, followed by reverse transcription and RT‒qPCR analysis. The 2−△△CT method was used to calculate the relative total amount of the gene of interest. Primer sequences are listed in Table 2.

Table 2 PCR primer sequences.Fecal microbiota DNA extraction and variable region PCR amplification

The target sequence was selected after DNA was extracted from the feces from the colon and rectum, and the 16S rRNA V3-V4 region was amplified. The primers 338F (5′⁃ACTCCTACGGGAGGCAGCAGCA⁃3′)and806R (5′⁃GGACTACHVGGGTWTCTAAT⁃3′) were used for amplification. 16S rRNA was sequenced to determine the variety, quantity and function of the bacteria composing the intestinal flora.

Hematoxylin-eosin(H&E), Periodic Acid-Schiff (PAS), and Masson staining to observe the pathological changes in kidney tissue

H&E staining: The kidney tissue was fixed with 4% paraformaldehyde solution and paraffin-embedded. After 3–5 min of staining with hematoxylin, the cells were differentiated with 1% acid ethanol (1 ml of hydrochloric acid and 99 ml of 70% ethanol), immersed in running water, and then stained with eosin for 0.5–1 min before dehydration and sealing. The slides were observed under a light microscope (200× and 400×).

PAS staining: The samples were subjected to dewaxing, periodic acidification, water washes, light bleaching, color development, dehydration and sealing, followed by observation with a light microscope (200× and 400×).

Masson staining: Sample preparation included dewaxing, overnight incubation with potassium dichromate, hematoxylin staining, acid fuchsin staining, phosphomolybdenic acid treatment, aniline blue staining, dehydration and sealing, followed by observation under a light microscope (200× and 400×).

Immunofluorescence for podocin expression in the kidney

After tissue collection, PBS washing, 4% paraformaldehyde fixation, bovine serum blocking, 0.5% Triton X-100 membrane permeabilization treatment for 10 min, overnight 1:400 primary antibody incubation, 1 h 1:100 fluorescent secondary antibody incubation, PBS washing, anti-fluorescence quenching, mounting agent mounting, and fluorescence microscopy were performed. Each slide was photographed under a 10×/40× fluorescence microscope.

Immunohistochemistry to reveal the expression of VDR, PGC1α and UCP-1 in kidney and adipose tissue

Paraffin section dewaxing, antigen retrieval, blockade of endogenous peroxidase, serum blocking, primary antibody (VDR (ab3508) 1:2000; PGC1α (ab191838) 1:2000; UCP-1 (ab23430) 1:1000) overnight 4 °C incubation, 1 h 1:2000 secondary antibody incubation, PBS washing, DAB chromogen development, counterstaining of nuclei, dehydration and sealing were performed. Each slide was observed and photographed under a 10×/20× microscope. The hematoxylin-stained nucleus was blue, and the positive expression of DAB was brownish-yellow.

Electron microscopy to observe pathological changes in the kidneys and perirenal adipose tissue

Kidney and perirenal adipose tissue (1 mm3) was fixed in 2.5% glutaraldehyde for 4 h, fixed in 1% osmium acid for 1 h and then rinsed with PBS. Then, 2% uranium acetate water staining was performed for 30 min after dehydration, embedding and trimming. The cells were stained with 4% uranium acetate for 20 min, stained with lead citrate for 5 min, and then observed by transmission electron microscopy (10,000×). Three fields of view were taken from each mouse kidney and perirenal adipose tissue section, 10 areas of glomerular basement membrane thickness were randomly and continuously measured in each field of view, and the average value was taken to represent the thickness of the glomerular basement membrane.

Construction of a VDR knockout vector and VDR-KO mice

The VDR gene sequence (Gene ID: 22337) was determined by querying the NCBI database, and the CDS fragment of VDR was synthesized. The overexpression plasmid was cloned into a lentiviral vector. Firstly, three recombinant lentiviral vectors (a, b, c) targeting different VDR gene sequences were constructed, and then the virus silencing effect was verified by RT-PCR experiments, and the experiments showed that the effect of vector a was better. Then, the virus liquid a was injected into the mouse through the tail vein and then transfected into the kidney tissue of Kkay mice, and the green fluorescence distribution in the kidney tissue was seen by fluorescence imaging, indicating that Lenti-s hVDR transfection was effective and VDR-KO mice were constructed successfully.

NovaSeq, bioinformatics analysis and statistical processing

NovaSeq Platform Sequencing (Paysenno Biomicrobiology LLC) was used to perform alpha and beta diversity and taxonomic composition analyses of the data. The analysis of between-group differences at the species and phylum levels was carried out using Metastats software.

SPSS 25.0 software and GraphPad Prism 8 were used for statistical analysis and graphing. Continuous variables were tested for a normal distribution, and continuous variables with a nonnormal distribution were logarithmically transformed to an approximately normal distribution. Measurement data are expressed as the mean ± standard deviation (SD). Independent sample t tests were used for comparisons between two groups, one-way analysis of variance (ANOVA) was used for comparisons between three groups or more, and the LSD test was used for two-by-two comparisons of multi-sample means. The Mann‒Whitney U test was used for determining bacterial taxonomic differences, Pearson correlation analysis was used for correlation analysis, and P < 0.05 indicated that the differences were statistically significant.