Human samples

Human osteoarthritis cartilage was obtained from patients undergoing total knee arthroplasty (n = 8). Normal control cartilage was obtained from traffic accident patients with no history of arthritis (n = 5). Cartilages were excised from the tibial plateau and femoral condyles during total knee replacement surgery. Cartilage samples were fixed in 4% paraformaldehyde, decalcified in 15% EDTA and paraffin-embedded for further histological analysis.

All human samples were obtained from the Third Affiliated Hospital of Southern Medical University, Guangzhou, China. All patients provided informed consent to use their clinical information for scientific research. This study was approved by the Ethics Committee of the Third Affiliated Hospital of Southern Medical University (2024-ER-001).

Animals

The col2a1-cre mice were purchased from Cyagen Biosciences, Jiangsu, China. The primers used are shown below. Forward: CTCTTCGCTATTATTCACCCTCAGCTT; Reverse: CTTGCGAACCTCATCACTCGTTG. Unique product lengths of 431 bp were generated. HDAC3flox/flox mice were purchased from GemPharmatech, Jiangsu, China. Both mice were of C57BL/6J background. To generate chondrocyte specific HDAC3 null mice, col2a1cre mice were bred with HDAC3flox/flox, and the HDAC3 chondrocyte-specific null mice were named HDAC3KO mice. The offspring mice carrying HDAC3flox/flox without CRE were used as the control group. Routine genotyping of tail DNA was performed according to the instructions of GemPharmatech and Cyagen Biosciences. The primers used are shown below. Forward: GTTAATCCGTGGGAGGATATTTTCT; Reverse: CCACTCAAACAAGCATACAGAGAAACA. Unique product lengths of 373 bp were generated.

For mice OA model, all C57BL/6J mice were purchased from the Laboratory Animal Center of Southern Medical University (Guangzhou, China). Twelve-week-old C57BL/6J mice and their littermate control mice underwent medial meniscus destabilization (DMM) surgery to induce osteoarthritis. To reduce the number of animals used, only male mice were used for experiments in this study. 20 mice were randomly assigned to experimental groups. The operative area was shaved, and the mice were selected to be fixed in the supine position with the left hind limb flexed at 90°, and the operative field was fully disinfected. The skin was cut to expose the patellar ligament, and the joint capsule was dissected along the inner edge of the patellar ligament with sharp knife scissors to bluntly clean out the intra-articular adipose tissue, and the medial meniscus was attached to the tibial plateau through the medial meniscus tibial collateral ligament (MMTL). After dissecting the MMTL and flushing the wound, the joint cavity was sutured, the skin wound was closed, and topical amoxicillin was applied to prevent wound infection. In the sham-operated group, only the joint capsule was dissected and then sutured layer by layer. The mice were also observed for anesthesia awakening and wound healing.

Mice were executed at 4 and 8 weeks postoperatively, and knee joint specimens were collected. The knee joints were fixed in 40 g/L paraformaldehyde for 24–48 h, decalcified in 100 g/L EDTA for 1 week, embedded in paraffin wax, sectioned in coronal position at 4 μm intervals, and stained with saffron O/solid green. The samples were scored using the Osteoarthritis Research Society International (OARSI) grading/staging system.

All animals were provided with standard feed and kept in pathogen-free cages with constant temperature and humidity. The circadian rhythm was maintained at 12 h. All animal experiments were approved by the animal protection and use Committee of the Ruiye model animal (Guangzhou, China) Biotechnology Co. (Guangzhou, China) and carried out according to the guidelines and regulations of the Committee (no. RYEth-20231008321).

Intra-articular delivery of HDAC3 and shParkin adeno-associated virus in experimental OA

Adeno-associated virus containing HDAC3 (AAV-HDAC3) (GENECHEM, Shanghai, China) and shParkin (AAV-shParkin) (GENECHEM, Shanghai, China) was administered to C57BL/6J mice with DMM-induced OA by intra-articular injection performed at 3-, 14-, and 21-day post DMM surgery. Specifically, a longitudinal skin incision was made to visualize the patellar ligament and the patella; then we injected 1 × 1010 AAV particles in a 10 µL volume into the knee joint cavity by inserting a small needle into the area underneath the patella of the leg. The control groups were all treated with negative control (AAV-NC) for the same periods. Mice were euthanized at 28 days post-surgery for histological analyses. The knee joints were fixed in 40 g/L paraformaldehyde for 24–48 h, decalcified in 100 g/L EDTA for 1 week, embedded in paraffin wax, and sectioned in coronal position at 4 μm intervals for further histological analysis.

Histological analyses

Tissue samples were fixed in 4% paraformaldehyde buffered with phosphate-buffered saline (pH 7.4) for 24 h at 4 °C. Specimens were decalcified with 10% EDTA (pH 7.4) for 2 weeks at 4 °C, embedded in paraffin and 4-µm thick sagittal sections were cut. Safranin O/Fast Green staining was performed according to standard protocols. Safranin O/Fast Green staining slides were used to evaluate cartilage degeneration by OARSI scoring system. Each section was assessed by two blinded, independent graders and the mean score was used for statistical analysis.

For OARSI scoring system, we recommend these 0–6 subjective scoring system to apply to all four quadrants of the joint: medial femoral condyle, medial tibial plateau, lateral femoral condyle, lateral tibial plateau. A score of 0 represents normal cartilage, 0.5 = loss of proteoglycan with an intact surface, 1 = superficial fibrillation without loss of cartilage, 2 = vertical clefts and loss of surface lamina, 3 = vertical clefts/erosion to the calcified layer lesion for 1%–25% of the quadrant width, 4 = lesion reaches the calcified cartilage for 25%–50% of the quadrant width, 5 = lesion reaches the calcified cartilage for 50%–75% of the quadrant width, 6 = lesion reaches the calcified cartilage for >75% of the quadrant width. The OA severity is expressed as a maximal score.

Immunohistochemistry and IF

Specimens were prepared as described previously. Following deparaffinization and rehydration, the sections were soaked in citrate buffer (10 mmol/L citric acid, pH 6.0) for 16–18 h at 60 °C to unmask the antigen for IHC and IF analyses. For IHC analysis, we added 3% hydrogen peroxide for 15 min. The sections were blocked with 1% sheep serum for 1 h at 37 °C and incubated with the primary antibodies (in 1% bovine serum albumin and 0.1% Triton X-100) overnight at 4 °C. For IHC staining, sections were stained with horseradish peroxidase-conjugated secondary antibodies (Proteintech, Hubei, China) and Horseradish Peroxidase Color Development Kit was used to observe the chromogen, with hematoxylin for counterstaining. For IF, sections were stained with Alexa 488 or Alexa 594 dye-labeled secondary antibodies (Thermo Fisher Scientific, MA, USA). Nuclei were labeled with 4, 6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, MA, USA) and images were obtained using a FluoView FV1000 confocal microscope (Olympus, Tokyo, Japan). Sections were randomly coded and scored by two blinded observers for three sections per joint.

Cell cultures

Primary articular chondrocytes were isolated from 3-day-old C57BL/6J mice knee joint cartilage according to a standard protocol using collagenase II. Primary chondrocytes were cultured in DMEM-F12 with 15% FBS. The medium was changed every day. For most experiments, primary cells were transferred to serum-free DMEM for 24 h before being exposed to stimulation.

Polydimethylsiloxane (PDMS) substrate preparation

PDMS substrates with different stiffness were prepared from the commercially available Sylgard 184 silicone elastomer kit (Dow Corning, MI, USA) by mixing base and curing agent in varying ratios (base polymer-to-cross-linker ratios, w/w). The pre-polymer mixtures were mixed thoroughly for 5 min, degassed, and poured into culture dishes for spreading. PDMS substrates were cured at 60 °C for 2 h, and the thickness of PDMS substrate was 1 mm. They were then immersed in ethanol for 3 h for sterilization, and washed with 1xPBS three times. We coated PDMS substrates with fibronectin (Millipore, MA, USA) for cell culture according to the manufacturer’s protocol.

Mechanical characterization

For each joint, two to three sections were chosen from the central, load-bearing region of the tibial cartilage that is in direct contact with condylar cartilage during joint loading (sections 10–30 cut from the medial to lateral ends, following trimming of the first 300 μm thickness at the medial end). The removed tissue was used for frozen sections, on each section, at a distance of about 20–40 μm from the tibial surface. The middle/deep region of the uncalcified cartilage layer of identified one or two regions of interest (ROIs). Within each ROI, AFM (Bruker Co., MA, USA) nanomechanical mapping was performed in a 40 × 40 grid (1 600 indents) using polystyrene microspherical tips up to ≈100 nN maximum indentation force at 10 μm/s effective indentation depth rate. For each indentation, the effective indentation modulus, Eind, was calculated by fitting the entire loading portion of the indentation force-depth (F–D) curve to the finite thickness-corrected Hertz model. All data analyses were performed using NanoScope Analysis2.0 (Bruker Co., MA, USA).

Senescence associated β-galactosidase (SA-β-Gal) assay

Cytochemical staining for SA-β-Gal was performed using an SA-β-Gal staining kit (Beyotime, Shanghai, China). Following the cell treatment, cytochemical staining for SA-β-Gal was performed at pH 6 according to the manufacturer’s protocol, and the positive cells in four randomly selected fields per treatment were counted (n = 5).

CCK-8 assay for cell viability

The assessment of cell viability was performed using the Cell Counting Kit-8 (Beyotime, Shanghai, China) reagent to evaluate cellular activity. chondrocytes were cultivated on 40:1, 10:1, and 5:1 PDMS substrates. At specified time points, the CCK-8 reagent was added to the culture medium. The cell-CCK-8 mixture was incubated at 37 °C in a cell culture for 1 h. Using a microplate reader (Thermo Fisher Scientific, MA, USA), measure the absorbance of each well at a wavelength of 450 nm.

Transmission electron microscope

Obtain chondrocytes cultivated on 40:1, 10:1, and 5:1 PDMS substrates. After washing with PBS, chondrocytes were scraped and harvested with 4% glutaraldehyde and centrifuged at 4 °C. The precipitated chondrocytes were continued to fix with 4% glutaraldehyde for another 2 h at room temperature and stored at 4 °C. Electron photomicrographs of the chondrocytes were taken by Scientific Compass Technology Co., Zhejiang, China.

Western blotting analysis

Tissues and cells were lysed using lysis buffer (62.5 mmol/L Tris-HCl [pH 6.8], 10% glycerol, 2% SDS, 50 mmol/L dithiothreitol, 0.01% bromophenol blue) at 96 °C for 10 min. The samples were separated by SDS-PAGE for 70 min and the proteins were subsequently transferred to membranes (Bio-Rad Laboratories, CA, USA) by the wet transfer method. Each membrane was incubated with primary antibodies overnight at 4 °C on a shaker. Following incubation with specific secondary antibodies, we detected the proteins with an enhanced chemiluminescence kit (Proteintech, Hubei, China). The following primary antibodies were used: p16INK4a (1:1 000, #18769, Cell Signaling), p21 (1:1 000, ab188224, Abcam), p53 (1:1 000 10442-1-AP, Proteintech), HDAC3 (1:1 000, 10255-1-AP, Proteintech), GAPDH (1:5 000, 10494-1-AP, Proteintech), PINK1 (1:1 000 for Western blot and 1:50 for Immunoprecipitation, #6946, Cell Signaling), Parkin (1:1 000, 14060-1-AP, Proteintech), Lc3 (1:1 000, ab48394, Abcam), MMP13 (1:1 000, 18165-1-AP, Proteintech), COL2A1 (1:1 000, #40772, SAB), Acetylated-lysine (1:100 for Immunoprecipitation, #9441, Cell Signaling) and GFP (1:200 for Immunoprecipitation, 66002-1-Ig, Proteintech).

Real-time qPCR

Total RNA was isolated from tissue and cell pellets with TRIzol Reagent (Takara Biotechnology, Tokyo, Japan) and reverse transcribed with reverse transcription reagent (Takara Biotechnology, Tokyo, Japan) according to the manufacturer’s protocol. Complementary DNA was used for real-time PCR with SYBR Premix Taq (Vazyme Biotech, Jiangsu, China) in a Light Cycler (Roche Molecular Biochemicals, Basel, Switzerland). Relative quantification of gene expression was performed with the comparative threshold method. Changes in mRNA expression levels were calculated after normalization to values for the GAPDH calibrator gene. The primers used are shown below. Pink1(Forward: CGGTCGCACACTGTTCCTCGT; Reverse: CCCTCCAGCAACTGCAAGGTCA), Prkn (Forward: TTCCGAATCACCTGACGGTT; Reverse: ATGACTTCTCCTCCGTGGT), Map1lc3a (Forward: CCCCAGTAAGATCCCGGTGA; Reverse: ATGATCTTGACCAACTCGCTCA), Ulk1 (Forward: AAACATCCTGCTGTCCAACCC; Reverse: GCCGCCATCATGTTGCTCT), Hspd1 (Forward: GTGTGAATTCCAAGATGCCTA, Reverse: TTATGACCAATGGCTTCCGAT), Sqstm1 (Forward: F: ACCCATCTACAGAGGCTGATCCC; Reverse: CCAGCCGCCTTCATCCGAGA).

siRNA transfection

Small interfering RNA (siRNA) oligonucleotides against mouse, Parkin and nontargeting scrambled control siRNA were purchased from GenePharma, Shanghai, China. Lipofectamine 3000 (Thermo Fisher Scientific, MA, USA) was used to transfect 100 nm siRNA-HDAC3 and siRNA-Parkin in opti-MEM (Thermo Fisher Scientific, MA, USA) following the manufacturer’s protocol. After 24 h of transfection, the cell culture media were replaced with fresh DMEM and incubated for a further for 48 h. The oligonucleotide sequences of Parkin siRNA were, forward: 5′GGA AGG AGC UUC CGA AUC ATT 3′; Reverse: 5′- UGA UUC GGA AGC UCC UUC CTT -3′; chondrocytes were transduced with siRNA when the cells were 30%–50% confluent.

Plasmid constructs and transfection

Mcherry-HDAC3 was prepared by cloning the corresponding HDAC3 DNA fragment into the mcherry-pcs2 vector using NheI and xhol restriction sites. EGFP-PRKN was purchased from MIAOLING BIOLOHY, Hubei, China. According to the manufacturer’s instructions, indicated plasmids were transfected using Lipofectamine 3000 (Thermo Fisher Scientific, MA, USA).

Immunoprecipitation

For immunoprecipitation assays, transduced and treated cells were lysed with RIPA lysis buffer supplemented with a completely EDTA-free protease inhibitor mixture (Beyotime, Shanghai, China) for 30 min on ice. Lysates were removed by centrifugation at 13 000 r/min for 15 min and the supernatant was collected. The protein-containing supernatant was incubated with primary antibody or 1 μg of normal mouse IgG (Proteintech, Hubei, China) as a control for 1 h at 4 °C with rotation. The protein lysates were subsequently incubated with 30 μL of pre-washed protein A-agarose beads (Beyotime, Shanghai, China) for 3 h at 4 °C with gentle rotation. The immunoprecipitates were analyzed by immunoblotting.

Mitochondrial membrane potential assay (JC-1)

We use JC-1(Beyotime, Shanghai, China) probe to detect the mitochondrial membrane potential. Chondrocytes inoculated in physiological and pathological hardness were resuspended in 0.5 mL of cell culture medium, 0.5 mL of JC-1 staining working solution was added and mixed by inverting several times. Incubate for 20 min at 37 °C in a cell culture incubator. After incubation centrifuge the cells at 600 g 4 °C for 3–4 minutes to precipitate the cells. Next, the cells were washed twice with JC-1 staining buffer: 1 mL of JC-1 staining buffer was added to resuspend the cells, centrifuged at 600 g 4 °C for 3–4 min to precipitate the cells, and the supernatant was discarded. Add 1 mL of JC-1 staining buffer to resuspend the cells, centrifuge at 600 g for 3–4 min at 4 °C, precipitate the cells and discard the supernatant. Finally, after resuspension with appropriate amount of JC-1 staining buffer, the red-green fluorescence ratio was detected by flow cytometry (BD, NJ, USA).

LC/MS-MS mass spectrometry-based proteomics

The sample was sonicated three times on ice using a high-intensity ultrasonic processor (Scientz, Zhejiang, China) in lysis buffer (8 mol/L urea, 1% protease inhibitor cocktail). The remaining debris was removed by centrifugation at 12 000 g at 4 °C for 10 min. Finally, the supernatant was collected and the protein concentration was determined with BCA kit according to the manufacturer’s instructions.

For digestion, the protein solution was reduced with 5 mmol/L dithiothreitol for 30 min at 56 °C and alkylated with 11 mmol/L iodoacetamide for 15 min at room temperature in darkness. The protein sample was then diluted by adding 100 mmol/L TEAB to urea concentration less than 2 mol/L. Finally, trypsin was added at 1:50 trypsin-to-protein mass ratio for the first digestion overnight and 1:100 trypsin-to-protein mass ratio for a second 4 h-digestion. Finally, the peptides were desalted by C18 SPE column.

The tryptic peptides were dissolved in solvent A (0.1% formic acid, 2% acetonitrile/in water), directly loaded onto a homemade reversed-phase analytical column (25-cm length, 75/100 μm i.d.). Peptides were separated with a gradient from 6% to 24% solvent B (0.1% formic acid in acetonitrile) over 70 min, 24%–35% in 14 min and climbing to 80% in 3 min then holding at 80% for the last 3 min, all at a constant flow rate of 450 nL/min on a nanoElute UHPLC system (Bruker Co., MA, USA).

The peptides were subjected to capillary source followed by the timsTOF Pro (Bruker Co., MA, USA) mass spectrometry. The electrospray voltage applied was 1.60 kV. Precursors and fragments were analyzed at the TOF detector, with a MS/MS scan range from 100 to 1 700 m/z. The timsTOF Pro was operated in parallel accumulation serial fragmentation (PASEF) mode. Precursors with charge states 0–5 were selected for fragmentation, and 10 PASEF-MS/MS scans were acquired per cycle. The dynamic exclusion was set to 30 s.

The resulting MS/MS data were processed using MaxQuant search engine (v.1.6.15.0). Tandem mass spectra were searched against the human SwissProt database (20422 entries) concatenated with reverse decoy database. Trypsin/P was specified as cleavage enzyme allowing up to two missing cleavages. The mass tolerance for precursor ions was set as 20 × 10−6 in the first search and 5 × 10–6 in the main search, and the mass tolerance for fragment ions was set as 0.02 Da. Carbamidomethyl on Cys was specified as a fixed modification, and acetylation on protein N-terminal and oxidation on Met were specified as variable modifications. FDR was adjusted to <1%.

Molecular docking

HDAC3–Parkin complex predictions were performed by Novopro, Guangdong, China. Briefly, 3D modeling of HDAC3 and Parkin was conducted in I-TASSER software. HDAC3 and Parkin docking was performed in BIOVIA Discovery Studio Visualizer software using ZDOCK algorithms. To gain more successive protein complex prediction, we reranked poses with the ZRANK scoring program: poses with a high density, high ZDOCK score and low ZRANK score were selected. The geometry of the selected docking solution was optimized using an energy minimization protocol and the Biovia Smart Minimizer algorithm. For the selected minimized solution, binding interface residues were identified and the types of interaction (for example, hydrogen bonds and electrostatic and hydrophobic interactions) were determined.

Statistical analysis

All experiments were performed at least three times. All statistical analyses were performed using SPSS Statistics for Windows, Version 28.0 (IBM Corp., NY, USA), and graphs were generated with GraphPad Prism 8.0. Except where indicated, data are displayed as means, with uncertainty expressed as 95% confidence intervals (mean ± 95% CI). For unpaired experiments, two-tailed Student t test, linear regression analysis, or two-way ANOVA was performed. For paired experiments, two-tailed paired t test or linear mixed effect models were utilized. We checked the features of the regression model by comparing the residuals vs. fitted values (i.e., the residuals had to be normally distributed around zero) and independence between observations. No correction was applied for multiple comparison because outcomes were determined a priori and were highly correlated. No statistical analyses included confounders (e.g., body mass in each animal) due to the small sample size. We conducted a complete case analysis in the case of missing data. In all experiments, P values < 0.05 were considered statistically significant. Throughout this text, “n” represents the number of independent observations of knees or cells from different animals. Specific data representation details and statistical procedures are also indicated in the figure legends.