Lipid extraction and analytical method for the estimation of OA concentration

1 × 106 cells were seeded in a Petri plate (n = 3 to 6). After differentiation and OA treatment, cells were resuspended in 225 µL of methanol (15,518,534, Thermo Fisher Scientific, Waltham, Massachusetts, USA) at 4oC. Cells lysis was performed for 20 s vortex three times, followed by 1 min in liquid nitrogen. Samples were kept on ice during thawing and were subjected to sonication (3 × 10 s 0.55 cycle 60% amplitude). Then samples were incubated under agitation for 1 h at 4oC with 750 µL of cold methyl-tert-butyl ether (MTBE) (143,312, Panreac Applichem ITW Reagents, Barcelona, Spain). After that, 750 µL of a solution of 0.1% C2H7NO2 (10,714,391, Thermo Fisher Scientific, Waltham, Massachusetts, USA) was added to each sample and vortexed, followed by a 10 min incubation at room temperature (RT). Samples were centrifuged at 10,000 x g for 5 min at 4oC to separate the two phases. The upper phase, containing apolar lipids, was transferred to a new tube and dried in a vacuum centrifuge. The pellet was dissolved in 100 µL of methanol. The volume of the lower phase containing polar proteins was measured, and four volumes of cold methanol were added and incubated for 1 h at -20oC and then centrifuged at 13,000 x g for 10 min at 4oC. The pellet was resuspended in 100 µL of RIPA buffer (10,230,544, Thermo Fisher Scientific, Waltham, Massachusetts, USA) plus protease and phosphatase inhibitor cocktails (4,906,837,001, Roche Applied Science, Indianapolis, IN, USA). Total protein was determined in the Tecan Infinite M200 pro plate reader by using a BCA protein assay and BSA as protein standard (10,741,395, Thermo Fisher Scientific Pierce, Grand Island, NY, USA).

The OA concentration was determined using a liquid chromatography-mass spectrometry (LC/MS) system (ACQUITY TQD, Waters, MA, USA). The chromatographic separation was performed using an ACQUITY UPLC C18 Kinetex column (Phenomenex, particle size 1.7 μm; 2.1 mm X 100 mm). The mobile phase was in isocratic mode MeOH: CHCl3: H2O (1:1:0.04). The flow rate used was 0.2 mL/min. The mass spectrometer was equipped with a Z-spray electrospray ionization source, and the samples were analyzed with the following conditions: capillary: 3 KV, cone: 40 V, extractor: 5 V, RF Lens: 0.3 V, source temperature: 120 °C, desolvation temperature: 300 °C, cone gas: 25 L/h, desolvation gas: 650 L/h. MS1 parameters were: LM resolution: 13; HM resolution: 13; ion energy: 1. MS2 parameters were: LM resolution: 13; HM resolution: 13; ion energy: 1; multiplier: 650 V. Spectra were acquired in negative ionization selected reaction monitoring (SRM) mode with an inter-channel delay of Spectra of 0.050 s. OA concentration was normalized to the total protein in each sample.

Cell lines and culture conditions

Transdifferentiated myoblast (TDM) and immortalized myoblast were obtained from the Institute of Myology, Paris, and were cultured as previously described [35]. Briefly, skin and skeletal muscle biopsies were obtained from a DM1-affected female and a healthy male donor (Table 1). Primary fibroblasts from skin biopsies of DM1 and control donors (Table 1) were immortalized by hTERT induction and transduced to conditionally express MyoD (hereafter referred to as primary transdifferentiated myotubes, pTDM) and cultured as previously described [15]. All experiments were carried out in 7-day differentiated cells except the experiment in which fusion index was determined in control cells at 0, 4, 7 and 10-days of differentiation. For fatty acid supplementation, cells were treated with 0.5 or 2 µM of OA, or 2 µM EA (01008 and E4637, respectively, Sigma Aldrich, San Luis, Missouri, USA), dissolved in 1% DMSO, that also served as vehicle-only control, for 24 h in opti-MEM (31,985,070, Thermo Fisher Scientific, Waltham, Massachusetts, USA). After fatty acid treatment, cells were supplemented with differentiation medium for 7 days. To treat cells with LXR (T 0901317, Tocris Bio-Techne, Bristol, UK) 1 × 106 TDM DM1 cells were seeded in a petri plate and differentiation medium was added after 24 h. At day 4 of differentiation LXR was added at a final concentration of 5 µM or 10 µM, 0.8% de DMSO. during 72 h. At day 7 cells were collected for OA determination.

Table 1 Cell lines informationToxicity assay

DM1 TDM were seeded in 96-well plates (1 × 105 cells/well). After 24 h cells were treated with LXR as described (concentrations ranging from 0.1 µM to 80 µM). Cell viability was measured after 7 days of differentiation. Briefly, 20 µL of MTS/PMS (CellTiter 96® Aqueous Non-Radioactive Cell Proliferation Assay, Promega, Madison, WI) was added to each well with 80 µL of differentiated medium. Cells were incubated for 4 h at 37 °C with 5% CO2 and absorbance at 490 nm was measured using Infinity Pro M200 plate reader. 4 biological replicates were performed for each condition.

Immunofluorescent methods

Cells were seeded in 24-well plates (3 × 105 cells/well) and were transdifferentiated for 7 days to carry out immunodetection of DESMIN, LC3B, and MF-20. After 24 h of the corresponding treatment, cells were fixed with 4% paraformaldehyde (PFA) for 15 min at RT. Immunodetection of Desmin was carried out with mouse anti-DESMIN (1:50, ab8470, Abcam, Cambridge, UK), goat biotin-conjugated anti-mouse-IgG (1:200, Sigma-Aldrich, San Luis, Missouri, USA) and Streptavidin Fluorescein (1:200, SA-5001-1, Vector laboratories, Newark, California, USA. For LC3B immunostaining rabbit anti-LC3B (1:3000, 51,520, Abcam, Cambridge, UK) and goat anti-rabbit-IgG (H + L) Alexa Fluor Plus 594 (1:200; Invitrogen, Carlsbad, CA, USA) were used. Immunodetections were performed as previously described [21]. Images were obtained with an LSM800 confocal microscope (Zeiss, Jena, Germany) at 200x magnification.

The fusion index was defined as the proportion of nuclei contained within myotubes (> 2 myonuclei) relative to the overall count of nuclei in each condition. The mean count of nuclei per myotube was ascertained by analyzing over 250 nuclei taken randomly from DESMIN-positive cells (5–7 micrographs). The diameter of myotubes was gauged at 5 points spanning the entire length of the tube. 50 myotubes were scrutinized for each distinctive experimental setup. Quantitative analysis was executed using the ImageJ software (NIH). LC3 puncta quantifications was performed using the Ifdotmeter software [36]. We conducted image analyses on myotubes stained with LC3. Briefly, the quantification of LC3 dots or puncta was executed on 15 − 20 images for each specific condition. The aggregate count of LC3 dots per image was adjusted in proportion to the entire area encompassing all the observed myotubes within each image. Measurement of myotube area was carried out using the ImageJ software. Data were expressed as the number of LC3 dots/µm2.er.

In the case of MF20, the immunostaining was performed as DESMIN but using mouse anti-MHC MF20 (1:20, MYH1E, Developmental Studies Hybridoma Bank, Douglas, USA).

For LysoTracker staining, cells were incubated 30 min at 37 °C with 100 nM of LysoTracker RED-DND99 (12,090,146, Invitrogen, Carlsbad, CA, USA), washed with PBS 1x and fixed with 4% PFA for 15 min. After three washes with PBS 1x, cells were mounted in Vectashield (Vector Laboratories, London, UK) with 2 µg/ml DAPI (4’, 6-diamidino-2-phenylindole). Images were acquired in an LSM800 confocal microscope (Zeiss) at 400x magnification.

Western blotting

Protein extraction, quantification, and immunodetection were performed as in [16, 21]. Membranes were incubated O/N with the corresponding primary antibody dilutions: mouse anti-β-ACTIN (1:5000, A5441, Sigma-Aldrich, San Luis, Missouri, USA), goat horseradish peroxidase (HRP)-conjugated anti-GAPDH (1:3500, sc-365,062, Santa Cruz, Dallas, Texas), rabbit anti-ATG4A (1:1000, #7613, Cell Signaling, Danvers, Massachusetts, USA), rabbit anti-LC3B (1:3000, 51,520, Abcam, Cambridge, UK), rabbit anti-MSI2 antibody (1:1000, EP1305Y, Abcam, Cambridge, UK), mouse anti-P62 (1:1000, 65,416, Abcam, Cambridge, UK), mouse anti-P21 (1:2000, #2946, Cell Signaling, Danvers, Massachusetts, USA), mouse anti-SCD1 (1:1000, 19,862, Abcam, Cambridge, UK). After three washes with 1x PBS-T, membranes were incubated for 1 h at RT with the corresponding secondary antibody dilutions: goat HRP-conjugated anti-rabbit-IgG (1:3500, A0545, Sigma-Aldrich, San Luis, Missouri, USA) or goat HRP-conjugated anti-mouse-IgG (1:5000, B7264, Sigma-Aldrich, San Luis, Missouri, USA). Images were acquired with an ImageQuant LAS 4000 or AMERSHAM ImageQuant 800 (GE Healthcare) and were quantified using ImageJ software (NIH).

RNA extraction and real-time quantitative reverse transcription PCR (qRT-PCR)

According to the manufacturer’s instructions, total RNA from 1 × 106 cells was extracted from each experimental replicate using the miRNeasy mini kit (217,004, QIAGEN, Hilden, Germany). For miRNA determinations, 2 µL of 5 ng/µL samples were reverse-transcribed with miRCURY LNA RT kit (339,340, Qiagen, Hilden, Germany). miR-7 expression was quantified using specific miRCURY LNA miRNA PCR primers (339,340, Qiagen, Hilden, Germany) and was normalized to U1 or U6 small nuclear RNA (snRNA) (339,306, Qiagen, Hilden, Germany) according to the manufacturer’s recommendations. For analyses of relative expression of genes, one microgram of total RNA was digested with DNase I and reverse-transcribed with SuperScript II (18,068,015 and 18,064,014, respectively, Invitrogen, Carlsbad, CA, USA) using random hexanucleotides (11,277,081,001, Sigma-Aldrich, San Luis, Missouri, USA). qRT-PCR was performed using 2 ng of cDNA template with 5x HOT FIREPol EvaGreen qPCR mix plus (ROX) (08-24-000 S, Solis BioDyne, Tartu, Estonia) and specific primers. Gene expression was normalized to GAPDH and GPI. The primers used were: GAPDH (fwd CATCTTCCAGGAGCGAGATC; rev GTTCACACCCATGACGAACAT), GPI (fwd CAGGGCATCATCTGGGACAT; rev TCTTAGCCAGCTGCTTTCCC) and MSI2 (fwd GCAGACCTCACCAGATAGCCTT; rev AAGCCTCTGGAGCGTTTCGTAG); HMGR (fwd TGCTTG CCGAGCCTAATGAAAG; rev AGAGCGTTCGTGGGTCCATC); FAS (fwd AAGGCTTTCGTGGGTCCATC; rev GATGCCAATTACGAAGCAGTTG); PGC1-α (fwd CCAAAGGATGCGCTCTCGTTCA; rev CGGTGTCTGTAGTGGCTTGACT); RNF145 (fwd GCAGGTTGTTCATCGGGCATTC; rev GGCTTACAGCACGGAAGTGTTTC); ABCA1 (fwd CAGGCTACTACCTGACCTTGGT; rev CTGCTCTGAGAAACACTGTCCTC); and SCD1 (fwd TGTGGTGAAGTTGATGTGCCAGC; fwd CCTGGTTTCACTTGGAGCTGTG).

qRT-PCRs were performed in a Step One Plus PCR system (Applied Biosystems, Foster City, CA, USA). Three experimental replicates and three repeats per biological sample were performed. Expression levels were normalized to the mean of reference genes using the comparative cycle threshold (Ct) method (2−ΔΔCt) [37].

Statistical analyses

Graphical outputs from statistical analyses used GraphPad Prism 9 software. In all experiments, we assumed that all parameters followed a normal distribution to compare normalized data means. For comparisons of two conditions, a two-tailed Student’s t-test (α = 0.05) was applied with Welch’s correction when necessary. For comparisons of more conditions, one-way ANOVA (α = 0.05) was applied, and Tukey’s HSD post hoc test when necessary. The correlation was measured with Pearson’s correlation coefficient.