Antibodies, recombinant proteins, and detection agents

Human (h) IL-6Rα, anti-mouse mAb-horseradish peroxidase (HRP), neutralizing anti-hIL-6R1 mAb, anti-mouse HRP-conjugated antibody, mouse IgG1κ isotype (anti-hIL-23 (p19)) were obtained from BioLegend, San Diego, CA, USA. hIL-6, anti-hIL-6R1 rabbit polyclonal antibody (pAb), and anti-Avi-Tag mouse mAb were obtained from antibodies-online, Aachen, Germany. Anti-hIL-6 rabbit pAb was obtained from AssayPro, St. Charles, AR, USA. Streptavidin-phycoerythrin (PE) was purchased from eBioscience, San Diego, CA, USA. Isotype control antibody MOPC-21 (mouse IgG1) was obtained from EXBIO Praha, a.s., Vestec, Czech Republic. Alexa Fluor 647-conjugated goat anti-mouse IgG F(ab’)2 fragment (GAM-AF647) was purchased from Jackson ImmunoResearch Laboratories, West Grove, PA, USA. Pierce High Sensitivity Streptavidin-HRP and anti-CD19 mAb PE-Alexa Fluor 610 were purchased from Thermo Fisher Scientific, Waltham, MA, USA. Anti-CD38 mAb PE/Dazzle 594 was obtained from PerkinElmer, Waltham, MA, USA. PE anti-CD126 (IL-6Rα) mAb was obtained from Sony Biotechnology, San Jose, CA, USA. Anti-pStat3 (Tyr705) rabbit mAb and anti-rabbit HRP-conjugated antibody were purchased from Abcam, Cambridge, United Kingdom. Anti-Stat3 mouse mAb was obtained from Cell Signaling Technology, Danvers, MA, USA. Anti-α-Tubulin mouse antibody was purchased from Sigma-Aldrich, St. Louis, MO, USA. Goat anti-rabbit Abberior STAR RED was purchased from Abberior, Göttingen, Germany.

HEK-Blue cell line and growth conditions

HEK-Blue IL-6 reporter cell line (InvivoGen, San Diego, CA, USA) used in the study was cultured in Dulbecco’s modified Eagle’s medium (DMEM) (BioSera, Cholet, France) containing 2 mM L-glutamine and 4.5 g/l glucose, supplemented with 10% heat inactivated fetal bovine serum (FBS), and antibiotics (100 U/ml penicillin, 100 µg/ml streptomycin, 100 µg/ml Normocin (InvivoGen, San Diego, CA, USA), and HEK-Blue Selection (InvivoGen, San Diego, CA, USA)) at 37 °C in 5% CO2. For the fluorescent microscopy, medium without Normocin and HEK-Blue Selection was used. For the signaling inhibition experiments, DMEM with 100 U/ml penicillin and 100 µg/ml streptomycin was used.

Ribosome display selection

According to the ABD-derived scaffold design, 11 residues of the ABD wild type (ABDwt) domain were randomized. The combinatorial NNK library was generated by assembly PCR and purified on 1% agarose gel, as described previously [22]. The gene construct, which was used for the ribosome display selection, contained the T7p (Bacteriophage T7 RNA Polymerase Promoter), ribosome binding site (RBS), ABD variant, TolA spacer, and lacks stop codon. The ribosome display protocol was adapted from Pluckthun’s laboratory protocol [22]. Ribosome display selection was carried out on the MaxiSorp immune plate (Nunc A/S, Roskilde, Sjælland, Denmark). hIL-6Rα at a concentration of 25 µg/ml was coated overnight in carbonate buffer (35 mM Na2CO3, 14 mM NaHCO3, pH 9.6), washed with TBS buffer (50 mM Tris-HCl, 150 mM NaCl, pH 7.4), and blocked with 3% BSA in TBS for 1 h at room temperature (RT). Following assembly, the combinatorial library was transcribed and translated using the PURExpress In Vitro Protein Synthesis Kit (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions. 1 µg of DNA was used per 50 µl reaction. WBT buffer (50 mM Tris-acetate, 150 mM NaCl, 50 mM MgAc, pH 7.0) with 0.5% BSA and 2.5 mg/ml heparin was added to the translation mixture. Additionally, ABDwt was added to the library mixture as a blocking agent to prevent unspecific binding of the ABD variants to the highly heterogeneous MaxiSorp surface. Then, library was transferred to a well coated with 3% BSA for pre-selection at 4 °C for 1 h. For selection, the library was transferred to a well coated with hIL-6Rα for 1 h at 4 °C. Unbound variants were washed with WBT buffer containing Tween20. A varied number of wash cycles and Tween20 concentrations were used in each selection round (Table S1). mRNA of the selected variants was released from ribosomes by elution buffer (50 mM Tris-acetate, 150 mM NaCl, 50 mM EDTA, pH 7.5), containing 50 µg/ml S. cerevisiae RNA and 2.5 mg/ml heparin. mRNA was purified using the High Pure RNA Isolation Kit (Roche, Basel, Switzerland) and transcribed to cDNA using GoScript Reverse Transcriptase (Promega, Madison, WI, USA). The library was assembled for the next round of selection using the same PCR assembly steps as in Ref [22], and the next round of selection followed. Three rounds were carried out. Finally, the enriched ABD library was cloned into the pET28 vector using NcoI (NEB, Ipswich, MA, USA) and BamHI HF (NEB, Ipswich, MA, USA) restriction endonucleases. The obtained plasmid library was called NEF, and gene constructs included HisTag – NEF variant – FlagTag – TolA – AviTag. Finally, the plasmids were introduced into the E. coli BL21-Gold (DE3) strain for protein production, and individual bacterial clones were used for ELISA screening.

Protein production

The overnight cultures of individual bacterial colonies of E. coli BL21-Gold (DE3) transformed with a gene of interest were grown in Luria-Bertani (LB) media with 60 µg/ml of kanamycin (Km) overnight at 37 °C. Overnight culture was inoculated in LB medium with Km at 50 times dilution. After the bacterial culture had reached OD600 = 0.6, protein expression was induced with 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) for 4 h at 37 °C. Bacterial cultures were centrifuged at 7000×g and 4 °C for 10 min. The cell pellets were harvested and stored at -20 °C. For the production of biotinylated protein in the E. coli BirA strain, a slightly modified protocol was used. Overnight cultures were grown in LB containing both Km and 30 µg/ml of chloramphenicol (Chp). Then, 50 mM d-biotin was added for 10 min. Protein production was induced with 1.5 mM IPTG for the next 4 h at 37 °C.

Bacterial lysate preparation

The harvested cell pellets were resuspended in lysis buffer (50 mM Tris-acetate, 300 mM NaCl, pH 7.4). Then, cells were disrupted on an ice bath by sonication using Misonix S3000 sonicator with the following program: total ON time 1-5 min; 5s ON/10s OFF; Power 12 W. Following, the cell lysate was centrifuged at 18,000×g and 4 °C for 20 min to remove cell debris.

Protein purification

Proteins were purified from a lysate using affinity chromatography with Ni-NTA agarose (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Briefly, cell lysate supernatant collected in the previous step was applied to 1 ml of Ni-NTA agarose, and flow-through was collected. The procedure was repeated three times, and the protein captured on Ni-NTA agarose was washed with the wash buffer (50 mM Tris-acetate, 300 mM NaCl, 20 mM imidazole, pH 8.0). Protein was eluted from Ni-NTA agarose with 1 ml of elution buffer (50 mM Tris-acetate, 150 mM NaCl, 250 mM imidazole, pH 8.0) per fraction and stored at 4 °C. To reduce endotoxin concentration, an additional purification step with isopropanol (50 mM Tris-acetate, 60% isopropanol, pH 8.0) was applied. To prepare endotoxin-free protein isolate, Polymyxin B-Agarose (Sigma-Aldrich, St. Louis, MO, USA) was used after Ni-NTA purification with isopropanol.

ELISA screening

The NEF proteins were produced in 5 ml E. coli BL21-Gold (DE3) bacterial culture and 1 ml cell lysates were used for the ELISA screening. Briefly, hIL-6Rα (2 µg/ml in carbonate buffer) was immobilized on the MaxiSorp plate at 4 °C overnight and blocked with Pierce Protein-Free Blocking Buffer (Thermo Fisher Scientific, Waltham, MA, USA) for 1 h at RT. Under similar conditions, lysozyme (2 µg/ml) was immobilized to test the specificity of the NEF variants. The bacterial lysate containing the NEF variant was 4,000 times diluted in PBSTB (PBS amended with 0.05% Tween20 and 1% BSA) and added in the following ELISA step. Next, after thrice washing with PBST (PBS with 0.05% Tween20), the NEF variant detection was carried out using α-Avi-Tag mouse mAb (1:5,000) and α-mouse mAb-HRP (1:5,000) in PBSTB. Following, 3,3’,5,5’-Tetramethylbenzidine (TMB) (TestLine, Brno, Czech Republic) substrate was added and incubated for 30 min in the dark at RT. Then, the reaction was stopped using 2 M H2SO4 and absorbance at 450 nm wavelength was measured for the degraded substrate using Epoch 2 microplate spectrophotometer (BioTek, Santa Clara, CA, USA).

Sequence analysis of selected variants

Plasmids containing NEF variants were isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany). DNA was eluted from a column using sterile water. Plasmids were sequenced using the pETup primer (5’-ATGCGTCCGGCGTAGA-3’). Sequencing data were analyzed using SnapGene software (GSL Biotech LLC, San Diego, CA, USA).

Binding ELISA

For binding ELISA, NEF variants were expressed in 100 ml culture of the E. coli BirA strain, and proteins were extracted and purified from lysates, as mentioned in earlier sections. Briefly, ELISA was carried out using hIL-6Rα (5 µg/ml in carbonate buffer) immobilized on the PolySorp plate overnight at 4 °C (Nunc A/S, Roskilde, Sjælland, Denmark). Also, BSA was immobilized to test the specificity of the NEF variants. Following, plates were blocked with PBSTB for 2 h at RT. Then, serially diluted, 5 times per step, NEF variants were added to hIL-6Rα and further incubated for the next 1 h RT. Neutralizing anti-hIL-6R1 mAb was used as a positive control, while mouse IgG1κ isotype (anti-hIL-23 (p19)) and ABDwt were used as negative controls. Detection was carried out using Pierce High Sensitivity Streptavidin-HRP (1:10,000) and anti-mouse mAb-HRP (1:5,000) in PBSTB. TMB was added and signal was detected as reported in previous section.

Competition ELISA

To perform competition ELISA, hIL-6Rα (1.5 µg/ml in carbonate buffer) was immobilized on the MaxiSorp plate overnight at 4 °C. Then, the plate was blocked with Pierce Protein-Free Blocking Buffer for 1 h at RT. Next, 0.25 µg/ml of hIL-6 together with an increasing concentration of the purified NEF variants in PBSTB was added and incubated for the next 1 h at RT. Anti-hIL-6R1 mAb was used as a positive control, while mouse IgG1κ isotype (anti-hIL-23 (p19)) and ABDwt were used as negative controls. Finally, hIL-6 was detected using anti-hIL-6 rabbit pAb (1:1,000) and anti-rabbit pAb-HRP conjugate (1:4,000) in PBSTB. TMB was added and signal was detected as reported in previous section.

Confocal microscopy

HEK-Blue IL-6 reporter cells were seeded on the sterile 24-well plate (TPP, Trasadingen, Switzerland) and cultured overnight. Following, hIL-6 (10 ng/ml concentration) was added to the cell culture and incubated for the next 3 h, adapted from Ref [23]. Meanwhile, in vivo biotinylated NEF variants (10 µg/ml or 250 nM concentration) were mixed with 4 µg/ml of Streptavidin-conjugated Alexa Fluor 568 (Invitrogen, Waltham, MA, USA) in DMEM, incubated for 30 min at RT, and centrifuged at 18,000×g for 10 min at RT. Afterwards, the NEF/Streptavidin complex was added to HEK-Blue IL-6 reporter cells and incubated for 5 h at 37 °C. Then, cells were washed five times with PBS and fixed with 4% paraformaldehyde (PFA) for 15 min at RT. Imaging was performed using the Zeiss LSM 780 confocal microscope. Under similar conditions, the HEK293T cell line was treated and used as a negative control to investigate the NEF specificity.

Additionally, NEF proteins detection on the hIL-6Rα-transfected HEK293T cells was also performed. Briefly, HEK293T cells were seeded on 18-mm cover glass (P-Lab, Prague, Czech Republic). After reaching 80% confluence, cells were transfected with the hIL-6Rα gene in the pcDNA6 vector, 1 µg DNA per transfection. Plasmid DNA was mixed with PEI at a ratio of 1:4 (w/w) and incubated for 20 min at RT. This mixture was then added to HEK293T cells in a serum-free medium, followed by 6 h incubation at 37 °C. Afterwards, the medium was exchanged with complete DMEM medium, and cells were incubated for the next 48 h. HEK293T cells treated with PEI reagent alone (no DNA) were used as a mock control. Meanwhile, the NEF variants were labeled with fluorescein isothiocyanate (FITC) (Sigma-Aldrich, St. Louis, MO, USA), where 50 ng of FITC in dimethyl sulfoxide (DMSO) was used per 1 µg of protein, and labeling was performed in carbonate buffer (pH 9.6) for 90 min at 37 °C. HEK293T (48 h post-transfection) cells were incubated with 40 µg/ml (1 µM) FITC-labeled NEF variants in DMEM for 1 h RT. Next, cells were washed five times with PBS and fixed with 4% PFA for 15 min. Afterwards, cells were washed three times with PBS and blocked with 1.5% BSA in PBS for 30 min. Following, cells were incubated with 5 µg/ml anti-hIL-6R1 rabbit pAb and 1 µg/ml goat anti-rabbit Abberior STAR RED antibody in PBST with 1.5% BSA. Finally, cells were transferred to the glass slide (P-Lab, Prague, Czech Republic) with mounting medium Vectashield with DAPI (Vector Laboratories, Newark, CA, USA). Imaging was performed using the Carl Zeiss LSM 880 NLO confocal microscope.

HEK-Blue IL-6 reporter cell assay

For the HEK-Blue IL-6 reporter assay, 3.6 × 104 HEK-Blue IL-6 cells in 180 µl volume per well were seeded on a sterile 96-well cell culture plate (Nunc A/S, Roskilde, Sjælland, Denmark). Then, cells in each well were incubated with 2–5 ng/ml hIL-6 for 21 h in the presence of an increasing concentration (up to 10 µM) of immobilized metal affinity chromatography (IMAC)-purified NEF protein or neutralizing antibody (TCZ or anti-hIL-6R1 mAb) in 20 µl volume. After the incubation, 20 µl of cell supernatant was mixed with 180 µl of the Quanti-Blue Solution and incubated for 3 h at 37 °C in the dark. To detect the secreted SEAP, absorbance at 620 nm was measured with Epoch 2 microplate spectrophotometer.

Flow cytometry assay

Cultured HEK-Blue IL-6 and HEK293T cells were collected and washed in HEPES-buffered salt solution (HBSS buffer; 10 mM HEPES, 140 mM NaCl, 5 mM KCl, pH 7.4) supplemented with 2 mM CaCl2, 2 mM MgCl2, 1% (w/v) glucose, and 1% (v/v) FCS (cHBSS buffer). 2 × 105 cells/sample in HBSS-Ca/Mg buffer was incubated with 10 µg/ml of biotin-labeled ligands (NEFs and ABDwt) for 30 min at 4 °C. Following this, the cells were washed with cHBSS buffer and then incubated with PE-labeled Streptavidin (1:400) at 4 °C for 30 min. Next, cells were washed and resuspended in cHBSS buffer, and finally investigated by flow cytometry using a FACS LSR II instrument (BD Biosciences, San Jose, CA, USA) in the presence of 1 µg/ml of Hoechst 33258. Then, the collected data was processed with appropriate gatings to exclude debris, cell aggregates, and dead cells (Hoechst 33258-positive staining) using the FlowJo software (BD Biosciences, Franklin Lakes, NJ, USA). The binding data was deduced from the mean fluorescence intensities (MFI) of cell-bound ligands and expressed as relative values, with the highest MFI value of the ligand taken as 100%. For antibody binding, 2 × 105 cells/sample were incubated with anti-hIL-6R1 mAb (1:100) or IgG1κ isotype control (1:100) in HBSS-Ca/Mg buffer at 4 °C for 30 min. Next, cells were washed and incubated with the GAM-AF647 antibody (1:500) at 4 °C for 30 min. After that, cells were washed and resuspended in cHBSS buffer and then analyzed by flow cytometry as described above.

LigandTracer assay

One day before the transfection, 1 × 106 HEK293T cells were seeded on a Petri dish (Nunc A/S, Roskilde, Sjælland, Denmark) and incubated overnight in a slant position in 5% CO2 incubator. Transfection with hIL-6Rα was carried out as above. Finally, after 18 h of post-transfection, binding of the NEF binders to the cell surface expressed hIL-6Rα was measured using the LigandTracer Green Line instrument (Ridgeview Instruments AB, Uppsala, Sweden) coupled with a Red (632 nm) - Near-infrared (NIR; 670 nm) detector. Herein, detection of the fluorescence signal corresponding to the in vivo biotinylated NEF binders was done as follows: (i) the baseline measurement was performed in the absence of the NEF proteins and fluorophores (only DMEM medium) for at least 15 min; (ii) during association phase, the fluorescence signal after addition of the in vivo biotinylated NEF variants preincubated with Streptavidin-APC conjugate was measured for at least 30 min (until the signal reached saturation state); and (iii) during dissociation phase, the measurement of the signal after medium exchange (DMEM only) was performed for at least 30 min (until the signal intensity was significantly reduced). Finally, the binding kinetics and ‘One-to-one’ or ‘One-to-one depletion corrected’ evaluation methods were applied for the calculation of kinetic parameters (ka, kd, and KD) using TraceDrawer 1.7.1 software.

For competition assay, NEF variants binding to the hIL-6Rα-transfected HEK293T cells was detected in absence or presence of hIL6 or TCZ using above protocol with slight modifications. Briefly, upon stabilization of baseline fluorescence signal, association phase was initiated by addition of selected concentration of in vivo biotinylated NEF variant to the cells. During the association phase, an increasing concentration of hIL6 (25 and 100 nM) or TCZ (3, 50 and 300 nM) were added to the cells at a specific interval (ca. every 30 min). Finally, the dissociation was performed by exchanging the culture medium containing NEF variants, hIL6 or TCZ with the fresh medium without additives. Under similar conditions, non-transfected HEK293T cells were treated with NEF variants and used as a negative control to investigate the NEF specificity.

Binding of NEF proteins to primary B cells

Peripheral blood mononuclear cells (PBMCs) isolation was performed in Ficoll-Paque PLUS medium (VWR, Radnor, PE, USA) using density gradient centrifugation. To get activated B cells, 2 × 106 PBMCs/ml were cultured in DMEM supplemented with 10% FBS, penicillin/streptomycin, and 5 µg PWM/ml at 37 °C for 96 h in 5% CO2 incubator. Unstimulated PBMCs were grown in the same cultivation medium without PWM under similar culture conditions. Next, cells were divided into aliquots – 2 × 105 cells per aliquot. Each aliquot was stained with anti-CD19 mAb PE-Alexa Fluor 610, anti-CD38 mAb PE/Dazzle 594, and 1 µg of NEF binder or 5 µl of PE anti-CD126 (IL-6Rα) mAb, incubated overnight at 4 °C. For NEF binder’s detection, Streptavidin-PE conjugate antibody was incubated for 30 min at RT. Samples were measured by the Sony SP6800 Spectral Cell Analyzer (Sony Biotechnology, San Jose, CA, USA) and the data was processed using FlowJo V10 software.

IL-6-mediated B cells differentiation inhibition assay

Herein, PBMCs were isolated as described in the NEF binding assay. Briefly, PBMCs were resuspended in complete RPMI 1640 medium containing 10% FBS and antibiotics (penicillin and streptomycin). Then, 1 × 106 cells per well were mounted on the 96-well panel. First, cells were incubated with 100 nM NEF binders for 2 h, and then 10 ng/ml hIL-6 was added to the cells. Following, cells were incubated for the next 7 days. On 4th day, one-half of the medium was replaced with fresh medium containing hIL-6 and NEF binders. On day 7, cells were stained for flow cytometry analysis. Herein, Fc receptors on the surface of B cells were blocked by 10% heat-inactivated human sera for 10 min at RT. After washing with PBS, anti-CD19 mAb FITC, anti-CD38 mAb PE-Texas Red, and anti-IgA mAb Pacific Blue were added to the cells, followed by 30 min incubation in the dark at RT. Finally, cells were washed with PBS and examined by the SONY flow cytometer SH800. Data was analyzed in FlowJo V10 software, and analyzed for statistical validation in GraphPad Prism software.

Cell proliferation assay

Briefly, 5 × 103 glioblastoma GAMG cells were seeded on a 96-well cultivation plate (TPP, Trasadingen, Switzerland) in 100 µl of complete DMEM. The next day, the culture medium was supplemented with a serial dilution of 1.6 µM to 0.003 µM for both the NEF binders (test) and ABDwt (negative control). Following, the cells were cultivated for the next 24 h, and the cell counting kit (CCK-8) (Sigma-Aldrich, St. Louis, MO, USA) reagent was added, followed by incubation for the next 2 h. Then, absorbance of the metabolized CCK-8 reagent was measured at 450 nm using a spectrophotometer. Finally, the proliferation rate of the cells was calculated from the calibration curve of non-treated cells, which were plated between 5 × 104 to 5 × 102 cells in 100 µl per well. The experiments for all the proteins were repeated twice in triplicates.

Scratch migration assay

The polydimethylsiloxane inserts (kindly provided by University of J. E. Purkyně in Ústí nad Labem, Ústí nad Labem, Czech Republic) were placed into wells of 6-well cultivation plates. Inserts allowed the seeding and culturing of GAMG cells into two separate chambers with a 1 mm thick partition between them. Briefly, 1 × 105 GAMG cells in 300 µl of complete DMEM (supplemented with 10% FBS and penicillin/streptomycin) were seeded in each chamber of the wells and incubated for the next 24 h. Then, the inserts were removed, which resulted in scratch (gap) formation in the wells. Following, the wells were rinsed twice with the culture medium to remove unattached cells, and the cell growth in the scratch area was checked using light microscopy. Next, the culture medium was replaced with a mixture of 2 ml of DMEM supplemented with 200 nM NEF binders (test) and ABDwt (negative control). Also, half of the samples were incubated with hIL-6 (50 ng/ml). Following, the cells were allowed to migrate in the scratch area by incubation at 37 °C for 48 h in 5% CO2 incubator. Finally, all the wells were washed with fresh medium to remove unattached cells, and cell migration was visualized using an Olympus light microscope. All the captured images were evaluated for scratch width using the ImageJ software Fiji. The experiments for all the proteins were repeated twice in triplicates.

Cell proliferation assay by Incucyte

In this assay, 5 × 103 cells (melanoma A2058 and pancreatic PaTu cancer cell lines) per well in DMEM enriched by NEF binders or controls were seeded on the 96-well plates. The following day, the growth medium was replaced, and continuous screening was initiated using Incucyte S3 Live-Cell Analysis System (Sartorius Lab Instruments GmbH & Co. KG, Goettingen, Germany). All experiments were performed in six technical replicates (wells) using four defined points for confluence measurement every 2 h for the next four consecutive days. The resulting confluence was determined using the Incucyte Cell-by-Cell Analysis Software Module (Sartorius Lab Instruments GmbH & Co. KG, Goettingen, Germany), and data (in%) were exported for statistical analysis.

Proliferation and cytotoxicity measurements by iCELLigence

Herein, 5 × 104 cells (human primary fibroblasts, melanoma (G361 and A2058) and pancreatic (PaTu and MiaPaCa) cancer cell lines) per well in DMEM enriched by NEF binders or controls, were seeded on the E-plates L8 (8 wells). Next, the continuous cell screening was initiated using the Real-Time Cellular Analysis (RTCA) iCELLigence instrument (Agilent Technologies, Inc., Santa Clara, CA, USA) for four consecutive days in standard incubator conditions. All experiments were performed in two technical replicates (wells); visualization and analysis were performed using RTCA software, the proliferation/cytotoxicity protocol, and normalized for presentation as the Delta Cell Index according to manufacturer instructions.

Migration (wound healing) assay by Incucyte

In this assay, cells (melanoma A2058 and pancreatic PaTu cancer cell lines) were seeded at 7 × 104 per well in 96-well plates. The next day, the medium was replaced, and cells were preincubated with inhibitors overnight. Afterwards, standardized wounds were created using Incucyte WoundMaker - a 96-pin mechanical device, and continuous screening was initiated using the Live-Cell Analysis System Incucyte S3. All experiments were performed in six technical replicates (wells) using two defined points for wound size measurement every 2 h up to three consecutive days. The resulting wound healing data acquired using the Incucyte Scratch Wound Analysis Software Module was exported and analyzed for statistical analysis.

Analysis of pSTAT3 activity in cancer cells

Pancreatic carcinoma (PaTu) cells were seeded at a density of 2 × 104/cm2 in a culture medium (DMEM supplemented with 10% FBS) and incubated for 24 h to fully attach and initiate proliferation. Consequently, the medium was replaced with a new complete medium enriched with NEF variants or ABDwt control, respectively. After overnight preincubation, cells were stimulated with hIL-6 (10 ng/ml) for 15 min and analyzed immunocytochemically. The phosphorylated STAT3 (pSTAT3) cell staining results were scored visually based on weighted intensity (assuming 0 for no staining, 1 for weak staining, 2 for moderate staining, and 3 for strong staining).. Mitotic cells are highlighted by black arrows. Examples of weakly positive nuclei (intensity = 1) are indicated by empty arrowheads, and medium-to-strongly positive nuclei (intensity = 2–3) are indicated by full black arrowheads.

Western blot

In this study, 6 × 105/ml U87MG cells in 2 ml were seeded on the 6-well plate overnight. Following, cell medium was exchanged with FCS-free DMEM and further incubated for 9 h at 37 °C. Then, pSTAT3 was induced by 100 ng/ml of hIL-6 in the presence of increasing concentrations of NEF variants, ABDwt, or TCZ in serum-free medium for 15 min. Next, cells were washed with ice-cold PBS and harvested with 100 µl of lysis buffer (25 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% Triton, 4 mM Na3VO4, pH 7.4) supplemented with protease inhibitor cocktail (1:100) (Sigma-Aldrich, St. Louis, MO, USA). After that, cell lysis was carried out on ice for 30 min and samples were centrifuged using 18,000×g at 4 °C for 10 min. The supernatant was used for protein quantification with the BCA assay (Thermo Scientific, Waltham, MA, USA). Afterwards, protein (45 µg of total protein per well) was mixed with sample loading buffer (200 mM Tris-HCl, 20% Glycerol, 10% SDS, 0.05% bromophenol blue, 125 mM DTT, pH 6.8) and heated for 5 min at 95 °C. Subsequently, proteins were separated using 12% SDS-PAGE gel electrophoresis. Then, gel was transferred onto a nitrocellulose membrane (0.2 μm, Bio-Rad, Prague, Czech Republic) and blocked with 5% milk PBST (0.1% Tween20). Anti-pStat3 (Tyr705) rabbit mAb (1:2,000) and anti-rabbit HRP-conjugated antibody (1:2,000) were then used to distinguish pSTAT3. Following, the membrane was incubated with SuperSignal West Pico PLUS Chemiluminescent Substrate (Sigma-Aldrich, St. Louis, MO, USA) at RT for 1.5 min to detect the specific pSTAT3 bands. Then, imaging was made with Azure 280 (Azure Biosystems, Sierra Court Suites, AB, USA). Antibodies were stripped using stripping buffer (12 mM glycine, 50 mM NaCl, pH 2.8) for 30 min at RT. After repeated blocking with 5% milk PBST, a total STAT3 was also detected with anti-Stat3 mouse mAb (1:1,000), and Tubulin was detected with anti-α-Tubulin mouse antibody (1:100). Finally, the anti-mouse HRP-conjugated antibody (1:2,000) was used for detection as described above.

Molecular modeling

We modeled the structure of the ABD-derived NEF binders based on the structure of the wild type ABD (pdb id 1gjt [24]) as the template using the MODELLER 9v14 software suite [25]. The IL-6Rα structure was obtained from the crystal structure of the ternary IL-6/IL-6Rα/IL-6R beta (β) complex (pdb id 1p9m [5]). For protein-protein docking with flexible side chains, we utilized a local version of the ClusPro server [26, 27], using chains A and C from the 1p9m structure as the receptor (corresponding to IL-6Rα domains 1 to 3, residues 24 to 321, according to the UniProt [28] record P40189 and hIL-6Rα domains 2 and 3, residues 115 to 315, according to the UniProt record P08887) and the modeled NEF variants as ligands. The docking results were visualized with PyMOL version 2.6.0 (The PyMOL Molecular Graphics System, Schrödinger, LLC, New York, NY, USA).

Determination of thermal stability

The fluorescence shift in tryptophan and tyrosine residues of the NEF variants in the temperature gradient was measured with the NanoDSF method using the Prometheus NT.48 instrument (NanoTemper Technologies GmbH, Munich, Germany). NEF samples were prepared in PBS (pH 7.4) at a concentration of 500 µg/ml and loaded into Prometheus Standard Capillaries (NanoTemper Technologies GmbH, Munich, Germany), followed by a rise in temperature from 20 to 80 °C at a rate of 1 °C/min. The excitation power was set at 70% while the tryptophan and tyrosine fluorescence emission intensities were measured. The resulting curves were plotted as a first derivative of the 350 nm/330 nm ratio as a function of temperature. Temperature melting points were estimated from the resulting curves.

Circular dichroism spectra measurement

Far UV circular dichroism (CD) spectra of NEF variants were measured using a Chirascan Plus spectrometer (Applied Photophysics, Surrey, UK). Samples were prepared in PBS (pH 7.4) at a concentration of 200 µg/ml. Samples were loaded into a quartz cuvette with a path length of 1 cm. The measurement was done within a range of 195–260 nm, 1 nm per step, at RT. The buffer spectra were subtracted from the resulting protein sample spectra. The analysis of CD data was done with the CDNN software (Applied Photophysics Ltd, Leatherhead, UK).

Induction and assessment of NEF108 protection in DSS-induced acute colitis

8-9 weeks old female C57Bl/6 mice (AnLab, Prague, Czech Republic) weighing between 18 and 22 g (weight before treatment) were kept under standardized conditions at a temperature of 21 -22 °C and conditions with a 12:12-h light/dark cycle and ad libitum access to food and water. We tested the effect of NEF108 protein in preventative-therapeutic regime of Dextran sulphate sodium (DSS)-induced colitis. NEF108 protein was administered by i.p. route in form of recombinant protein solution in sterile PBS once a day. Administration of NEF108 started three days before the induction of acute colitis by providing 2.5% DSS in drinking water (w/v) DSS (MW approximately 40 kDa; TdB Labs, Uppsala, Sweden) and followed for next 4 days together with DSS. At the end of experiment, the animals were euthanized by cervical dislocation in Ketamine/Xylazine anesthesia. The length of the colon was measured between the caecum and proximal rectum. The terminal third of the colon was dissected into pieces for Real Time RT-PCR (qRT-PCR) and histochemistry. Tissues for IL-1β mRNA expression was determined according to previously reported method [29]. For the elimination of DSS residues lithium chloride RNA purification was performed [30]. IL-1ß forward primer sequence was TGCCACCTTTTGACAGTGATG and reverse primer was ATGTGCTGCTGCGAGATTTG. Tissue samples for histology were fixed in 10% neutral-buffered formalin (Merck), and paraffin-embedded. Sections were stained with hematoxylin and eosin (H&E, Merck) and classified by a pathologist without prior knowledge of treatment status of individual mouse according to the classification published by Erben et al. [31], Table S4. BX43 microscope equipped with CCD camera was employed (Olympus, Tokio, Japan). Experimental protocol was approved by Ethics Committee of the Faculty of Medicine and Dentistry (Palacky University Olomouc, Czech Republic), and the Ministry of Education, Youth and Sports, Czech Republic (MSMT-10,947/2021-3).

Statistics and reproducibility

All the experiments were performed at least two times with a minimum of technical triplicates, unless otherwise specified. GraphPad Prism version 8.0.1 (GraphPad Software Inc., San Diego, CA, USA) or OriginLab version 2023b (OriginLab Corporation, Northampton, MA, USA) was used for the statistical analysis. Error bars indicate the mean ± standard deviation (SD), unless noted otherwise. On the generated data sets, one-way ANOVA (p < 0.05) with Tukey’s post-hoc test was marked as statistically significant. Respective significance values are also indicated in the figure legends.