Animals

C57BL/6 mice (male, 6 weeks old, 25–30 g) were purchased from the Biotechnology Corporation of Dashuo (Chengdu, China) and housed in pathogen-free facilities. All the animal raising and handling protocols were approved by the Animal Care and Use Committee of the Hospital of the University of Electronic Science and Technology and Sichuan Provincial People’s Hospital.

Isolation and culture of mouse NSCs

NSCs were harvested from the cerebral cortices of 14-day-old C57BL/6 mouse embryos. Fetal brain tissue was acquired by laparotomy under aseptic conditions. Brains were harvested under a stereomicroscope, meninges and blood vessels were carefully stripped, and the cerebral hemisphere was separated. Then, we used microsurgical forceps to cut the cerebral hemisphere tissue and digest it with 0.175% trypsin (DNase 50:1) for 10 min. An equal volume of culture medium containing 10% (v/v) fetal bovine serum (FBS; Gibco) was added to terminate the digestion. Cells were dispersed by pipetting repeatedly to create a single-cell suspension with culture medium and filtered through a 40 µm sieve. Fresh medium was supplied every 2–3 days and cells were passaged every 5–7 days.

Mouse embryonic fibroblasts (MEFs) isolation and ESCs cultures

MEFs were harvested from the cerebral cortices of 14-day-old C57BL/6 mouse embryos. The head and internal organs were removed, and the torso was minced and dispersed in 0.25% trypsin–EDTA (DNase 50:1) for digestion for 15 min. After repeated gentle blowing and beating the tissue, the cell suspension was neutralized by an equal volume of MEF complete medium (DMEM/F12,10% FBS,1% penicillin–streptomycin). Finally, cells were filtered with a 30 μm cell strainer. The cell suspension was centrifuged (1000 rpm for 5 min) and resuspended with complete culture medium, and then inoculated in a 100 mm culture dish coated with 0.1% gelatin, recorded as P0. All cells were cultured in a 37 °C, 5% CO2 incubator. Mouse ESCs were purchased from Oricell (Cyagen Biosciences, Guangzhou, China, MUBES-01001) and cultured in mouse ESC growth medium (Oricell, MUBES-90011) on plates precoated with gelatin solution and MEFs as feeder cells.

Microarray analysis

Total RNA was isolated from the cells of each group using TRIzol reagent (Invitrogen). RNA expression profiling was then performed using the Agilent mouse lncRNA + mRNA microarray V2.0 platform. The arrays were scanned by the Agilent G2565CA Microarray Scanner. Agilent Feature Extraction software (version 11.0.1.1) was used to analyze acquired array images. Quantile normalization and subsequent data processing were performed using the GeneSpring GX v11.5.1 software package (Agilent Technologies). Differentially expressed genes were identified by fold change filtering.

Cell transfection and the generation of stable cell lines

NSCs were cultured in complete media. Stable linc-NSC knockdown cells were generated by infection with lentivirus-based shRNA. A linc-NSC knockdown lentivirus as well as a control lentivirus were purchased from Hanheng Biotechnology (Shanghai, China). The lentiviral-based vector pHBLV-U6-Scramble-ZsGreen-Puro was used to express shRNA (shRNA construct: GATCCGAGCTGACTTCTTAGGGCGATGGTATTCAAGAGATACCATCGCCCTAAGAAGTCAGCTCTTTTTTG) while a lentivirus-expressing non-target shRNA control (5´-GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC) was used as a control. NSCs (P2) were transfected according to the supplier’s instructions. Viral stocks were added at 10 multiplicity of infection (MOI), and cell-virus suspensions were centrifuged in ultra-low-adhesion round bottom 24-well plates at 37 °C for 24 h before they were resuspended in 2 mL of medium and transferred to a 6-well dish. After 5 days, puromycin was added at 0.1 µg/mL to select transfected cells.

Mouse ESCs were cultured in mouse ESC growth medium on plates that were precoated with gelatin solution and MEFs as feeder cells. Stable ESCs were transduced with the linc-NSC overexpression lentivirus and the linc-NSC overexpression control lentivirus and then cultured. The linc-NSC overexpression lentivirus, as well as the control lentivirus, were purchased from Hanheng Biotechnology (Shanghai, China). The overexpression lentivirus vectors were used by VP001-CMV-MCS-EF1-ZsGreen-T2A-Puro and ESCs were transfected according to the supplier’s instructions (Hanheng Biotechnology, Shanghai, China). Virus stocks were added at 400 MOI; 48 h after viral infection, puromycin (2 µg/mL) was added for screening. During the screening process, if there were too many dead cells, the puromycin-containing culture medium was replaced, and the colonies were grown and passaged (1:5). After three days of screening, we replaced the culture medium containing puromycin (1 µg/mL), and continued to culture for two generations for subsequent experiments.

Transfection efficiency was determined by calculating the proportion of GFP-positive cells via fluorescent microscopy (Zeiss AX10). Cells were used for experiments within five passages post- transfection. For all the following experiments, the cells in each group had a good growth state.

Quantitative real-time PCR

The quantification of mRNA levels of pluripotency and neurogenesis genes were analyzed by qPCR and normalized to β-actin (Actb). Total RNA was extracted from the cultured cells (R701-01, Vazyme). Reverse transcription was performed using HiScript III All-in-one RT SuperMix (R333-01, Vazyme) according to the manufacturer’s protocol. The qPCR was used to determine linc-NSC knockdown in the shRNA group, the overexpression group, and the control group and was performed with Taq pro Universal SYBR qPCR Master Mix (Ref Q712-02, Vazyme). The qPCR reactions were run on a Bio‐Rad real‐time qPCR system (Bio‐Rad). Quantitative results for each sample were determined by the 2−∆∆Cq method by PCR amplification. Primers are listed in Supplementary File 2.

Proliferation assay

Cell viability was measured by the CCK-8 assay (A311, Vazyme). In brief, cells were seeded in 96-well plates at a density of 10,000 cells/well in 100 µL of culture medium and fed in the incubator overnight. CCK-8 solution (10 µL per 100 µL medium) was then added to each well. Subsequently, we incubated the plates for 2 h in a 5% CO2 atmosphere, and the absorbance at 450 nm was measured using a microplate reader. Cell viability was represented as a proportion (%) of the control.

Flow cytometry

Cells were detached by Accutase (Sigma-Aldrich) for 5–10 min, fixed with 4% paraformaldehyde at room temperature for 30 min, and then permeabilized with 70% ethanol for at least 2 h at 4 °C using a Cell Cycle and Apoptosis Analysis Kit (Beyotime) and Apoptosis Detection Kit (BD Biosciences). The quadrants of these plots indicated live cells (AnV−/PI−;), early-stage apoptosis (AnV + /PI−;), or late-stage apoptosis (AnV + /PI +). Each sample was analyzed by flow cytometry using a Guava easyCyte (Millipore) equipped with a 488-nm blue laser. Dead cells and debris were excluded by gating on forward scatter and pulse-width profiles.

Stereotaxic injections

C57BL/6 mice (male, 6–8 weeks old) were allocated randomly to experimental groups: a shRNA group, a shRNA-control group, an overexpression group, and an overexpression control group. Animals were anesthetized with 1% pentobarbital sodium and maintained under deep anesthesia using 2% isofluorane. Mice were fixed in a brain stereotaxic apparatus (RWD Life Science) and depilated. An iodophor was used for disinfection and a paved sterile sheet was used. The site of injection was located 1 mm lateral to the medial sagittal suture, 5.5 mm rostral to the lambda, and 2.0 mm in depth under the dura mater. Injections were performed with a 10 μL microinjector at a speed of 0.5 μL/minute; 5 μL of stable cell line suspension was injected into each group with a total of 1 × 106 cells. The injection needle was held in position for 10 min and then slowly removed. Finally, the scalp was sutured.

Hematoxylin–eosin (HE) staining

Brain slices were removed from the refrigerator, rewarmed at room temperature, and then washed three times with 1 × PBS for 5 min. The sections were stained with hematoxylin staining solution and observed repeatedly under a microscope for 7–8 min during the staining process. The brain slices were then removed and rinsed with running water for 20 min. The sections were then differentiated with a differentiation solution for 30 s and rinsed with running water for 15 min. Then, the sections were stained with eosin staining solution for 2–3 min and observed repeatedly under a microscope during the staining process. The brain sections were removed and rinsed with running water for 5 min. Then, the sections were successively dehydrated and cleared in 95% ethanol (I), 95% ethanol (II), 100% ethanol (I), 100% ethanol (II), xylene (I), and xylene (II) for 1 min each and then sealed with neutral gum.

TUNEL assay and imaging

The animals were anesthetized and perfused with 0.1 M phosphate buffered saline and 4% paraformaldehyde. The fixed tumor tissues were extracted, embedded in paraffin, and cut into 5 μm sections. The sections were subjected to IHC or TUNEL staining, counterstained with 4′,6-diamidino-2-phenylindole (DAPI), and observed under a fluorescence microscope (Nikon, Kyoto, Japan).

In vivo tumorigenesis in mice

Mice were randomized into the two groups. The animals were removed from the cervical vertebra and sacrificed after two and four weeks after implantation of cells, and tumor tissues were harvested, photographed, and weighed. Later, some tumors were placed in liquid nitrogen quick-freezing and stored in a refrigerator at − 80 °C for future use. All animal experiment procedures had been approved by the Medical Ethics Committee of Sichuan Provincial People’s Hospital (Approval Number: 2022-154).

Immunofluorescence microscopy

Tissue immunofluorescence staining was performed using a series of 10-µm-thick sections (Leica Instruments). Cells were cultured in a complete medium containing 10% FBS and plated on slides coated with poly-D-lysine (PDL; Sigma-Aldrich, 5 ×). After 5 days, cells were fixed with 4% paraformaldehyde for 20 min at 4 °C followed by the permeabilization of cells for 10 min with 0.1% (vol/vol) Triton X-100. Cells were then blocked with 1% BSA solution in phosphate-buffered saline (PBS). Sections and cell climbing slices were incubated with the following primary antibodies: rat anti-Nestin (1;200, Abcam, MA, USA), rabbit anti-NeuN (1:200, Abcam, MA, USA), rabbit anti-GFAP (1:300, CST, MA, USA) or goat anti-Olig2 (1:200, Abcam, MA, USA) antibodies at 4 ℃ overnight. After washing with PBS, sections were then incubated with Alexa Fluor 555-conjugated chicken anti-goat IgG (1:1000; CST, MA, USA) antibody, Alexa Fluor 555-conjugated goat anti-rabbit IgG (1:1000; CST, MA, USA) antibody, and Alexa Fluor 488-conjugated goat anti-rat IgG (1:1000; CST, MA, USA). Finally, the coverslips were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Beyotime) and imaged with a confocal microscope (Zeiss LSM800, Germany).

Western blotting

RIPA lysis buffer (Beyotime, Beijing, China) containing 1% protease and 1% phosphatase inhibitors was added to the lysed cells. Then, a BCA kit (Vazyme Biotech, Nanjing, China) was used to determine protein concentrations from each group. A one-quarter volume of 5 × SDS loading buffer was added to each sample which was then heated for 5 min at 100 °C to denature proteins. Next, protein samples (25 μg per sample) were separated by 10–15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Once separated, proteins were transferred to a PVDF membrane, which was then blocked in 5% skimmed milk at room temperature (RT) for 1 h. Next, the PVDF membranes were incubated with primary antibodies at 4 °C overnight. The next morning, the PVDF membranes were washed three times in 1% TBST and incubated with relevant secondary antibodies for 1 h at RT. Finally, the membranes were washed in TBST and imaged with a Tanon-5200 chemiluminescent imaging system (Tianneng Technology Co., Ltd., Shanghai, China).

Statistical analysis

Data were analyzed and significance was determined by GraphPad Prism version 6.02 software. Results are shown as means ± standard error (SE). Statistical significance was evaluated by a two-tailed, unpaired Student ‘s t-test or by one-way analysis of variance (ANOVA) followed by the Bonferroni test for multiple comparisons; p values < 0.05 were considered significant.