Cell culture

All cell lines used in this study were obtained from the ATCC. Authentication was performed by the Multiplex Human Cell Authentication (MCA) test to exclude cross-contamination between the cell lines, which was last confirmed on July 18th, 2022. All cells were grown as monolayers to a confluence of approximately 90% before subculturing. A549 cells were grown in DMEM (PAN Biotech, DE) supplemented with 10% FCS (PAN Biotech, DE), 2 mM L-glutamine (PAA Laboratories, AT), and 200 U/mL Pen/Strep (200 U/mL; Thermo Fisher Scientific, US) in 10% CO2 at 37 °C. HTB56 cells were grown in MEM (Gibco BRL, Thermo Fisher Scientific, US) supplemented with 10% FCS, 2 mM L-glutamine, 200 U/mL Pen/Strep, 1% NEAA (MEM nonessential amino acid solution; Sigma‒Aldrich, US), and 1% sodium pyruvate (Gibco BRL, Life Technologies, DE) and incubated in 5% CO2 at 37 °C.

Generation of HERC5-overexpressing and -luciferase-expressing cell lines

HEK293T cells at approximately 80% confluency were transfected with 3 µg of either the LEGO-iG2-HERC5-HA or LEGO-iG2-HA plasmid for overexpression or 5 µg of the pHIV-luciferase plasmid (Addgene, US), 3750 ng of the psPAX2 packaging plasmid (Addgene, US) and 1250 ng of the pMD2.D envelope plasmid (Addgene, US), 20 µL of Lipofectamine 2000 (Invitrogen, US) reagent and 500 µL of OptiMEM (Gibco, US). The transfection mixture was replaced with standard medium 12–15 h after transfection. The virus-containing supernatant was collected after an additional 48 h and filtered using 0.45 µm syringe filters (Millex, DE). Viral stocks were stored at -80 °C. 200 µL of lentiviral particles were added dropwise to cultured HTB56 cells at approximately 80% confluency in media containing polybrene (1:1000, Fluka (Thermo Fisher Scientific, US)) to enhance transduction efficiency. 24 h after viral transduction, the media was changed. Cells overexpressing HERC5 or empty vector control were sorted by fluorescence-activated cell sorting (FACS) at 488 nm and recultured for further experiments.

Generation of a HERC5 knockout cell line

A549 HERC5 KO cells were generated by using clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated nuclease 9 (Cas9) technology. For efficient knockout of the HERC5 gene, different CRISPR guides were tested for efficiency and cloned and inserted into pSpCas9(BB)-2A-GFP (PX458, Addgene, US). Finally, sgRNA_HERC_5_sense (CACC GCGCAACGGGCGCTCGACCGC) and sgRNA_HERC_5_antisense (AAAC GCGGTCGAGCGCCCGTTGCGC) were chosen. After A549 cells were transfected with Lipofectamine 2000 according to the manufacturer’s protocol, successful HERC5 KO was verified by Western Blotting and Sanger sequencing of individual expanded cell clones. After 5 days, single GFP-positive cells were isolated using fluorescence-activated cell sorting (FACS) and clonally expanded. To minimize off-target effects, a pool of four different KO clones was selected to generate the A549-HERC5 KO cell line.

Western blotting

To generate whole-protein lysates, cells were grown to a confluence of 90%, washed with PBS, and detached from the culture flask surface. The pellet was resuspended in 2% SDS sample buffer containing Complete Protease Inhibitor (Roche Applied Science AG, DE) and PhosSTOP (Roche Applied Science AG, DE) phosphatase inhibitors and homogenized by sonication. A Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, US) was used according to the manufacturer’s instructions to quantify the protein concentration of the whole-cell extracts. SDS‒PAGE was performed using 8% and 4‒20% (NIPPON Genetics Europe, DE) polyacrylamide gels under denaturing conditions, after which the proteins were blotted on nitrocellulose membranes. Blocking was performed in 5% (w/v) milk powder/PBS-T or 5% (w/v) BSA/TBS-T for 1 h at RT. The following antibodies were used for detection: HERC5 (Abnova, TW; A01, 1:1000, o/n) and HSC70 (Santa Cruz Biotechnology, US; B-6, 1:2,000,000, o/n). For western blots depicting cellular responses to immune activation, the cell lines were treated with IFNγ (10 ng/ml; PeproTech, US) and TNFα (50 ng/ml; PeproTech, US) for 24 h and 48 h. Detection of the western blots was performed using ISG15 antibody (CST, US; #2743, 1:1000 o/n).

Methylene blue proliferation assay

Commonly used proliferation assays (e.g., MTT assays) are dependent on the metabolic conversion of MTT by NAD(P)H oxidoreductases. Therefore, methylene blue assays were used to assess the proliferation rates of the cell lines according to Felice et al. (2009) [27]. For this purpose, either 1000 HTB56 or 500 A549 cells were seeded in 96-well plates and placed in an incubator until the day of the measurement at days 1 (A549), 2 (HTB56), 4, 6, and 8 (both cell lines). Cells were treated with 100 ng/mL oligomycin (A549) according to Hao et al. (2010) [28] and 1 ng/mL oligomycin (HTB56). For detection, the cell culture supernatant was discarded, and the cells were washed with 300 µL of PBS. 50 µL of staining solution (1.25% glutaraldehyde and 0.6% methylene blue in Hanks Balanced Salt Solution (Hanks Salt Solution [Biochrom GmbH, DE], 0.8 mM MgSO4, 1.3 mM CaCl2) was added to each well, and the mixture was incubated for 1 h at 37 °C. The staining solution was discarded, and each well was washed by rinsing the plate six times in dH2O. After drying, 100 µL of elution solution (50% ethanol and 1% acetic acid in PBS) was added to each well and was also used as a blank. Methylene blue was eluted from the cells by shaking on a plate shaker (450 RPM) for 15 min. The absorbance was read at 600 nm in a plate reader (GloMax Discover, Promega, US).

To evaluate differences in proliferation ratios, the absolute values on day 8 and days 1 (A549) and 2 (HTB56) were calculated, and the relative growth of the cell lines was assessed. The groups were compared by one sample t test.

Clonogenic assay

To determine the ability of single cells to grow into a colony, 1000 cells were seeded in 6-well plates and imaged after 7 days. After removal of the media, the cells were washed with PBS, and the colonies were fixed with 4% (w/v) PFA/PBS for 10 min. Subsequently, the colonies were stained with 0.5% (w/v) crystal violet/H2O solution for 30 min and gently washed with ddH2O to remove excess staining solution. Colonies were detected using the ColonyArea plugin for ImageJ [29].

Anchorage-independent growth assay

To produce the bottom agar solution, 2 mL of cell culture media and heated agar solution (42 °C; final concentration: 0.5% in ddH2O) were mixed, poured into 6-well plates, and left to harden. For each well, 1 mL of top agar was layered on top of the bottom agar, consisting of 2/3 bottom agar and a 1/3 cell suspension (3000 cells). After 14 days, 200 µL of MTT was added dropwise to the wells, and the plate was imaged after 3 h. Colonies exceeding a diameter of 100 µm were counted using the Cell Colony Edge macro for ImageJ [30]. The detection parameters were altered to “Number of pixels/units” = 0.0945; “Rolling Ball Radius” = 50; “Analyze Particles—Min size” = 7854 and “Analyze Particles—Min circ” = 0.5.

Migration assay

The transwell migration assay was performed by plating 500 µL of FCS-deprived media containing 20,000 cells into cell culture inserts (BD Falcon, DE; 8 µm pores), while media containing 10% FCS as a chemoattractant was placed in the lower chambers. After 16 h, the media was removed, and the membrane was washed in PBS and fixed with 4% (w/v) PFA/PBS for 10 min. The cells were permeabilized with methanol for 20 min and stained with 0.5% (w/v) crystal violet/H2O solution for 10 min. The excess staining solution was removed by washing in PBS. Nonmigrated cells were scraped from the inside of the inserts with sterile cotton. The membrane was imaged under a brightfield microscope (Zeiss, Axiovision), and the cells were counted manually.

Wound healing assay

For each cell line, 1*106 cells were plated in 6-well plates and incubated at 37 °C until a confluent monolayer was formed. Using a 100 µL pipette tip, straight scratches were made in the middle of the well. The cells were washed with PBS to remove cell debris and covered in culture medium. The scratches were imaged at a defined position at 0 h and after 18 h of incubation to analyze the extent of wound healing that had taken place. The results were analyzed using the “Wound_healing_size_tool” plugin for ImageJ [31]. The mitochondrial activity was visualized using MitoTracker™ Green FM and MitoTracker™ Red CMXRos kits according to the manufacturers’ instructions (Thermo Fisher Scientific, US) using 20 nM for 30 min for both dyes.

In vivo zebrafish experiments

Zebrafish experiments were carried out in the Zebrafish Core of Turku Bioscience Centre (Turku, Finland). The overall process of generating zebrafish xenografts has been described in detail earlier [32]. In brief, zebrafish embryos of the Casper strain were obtained through natural spawning. The collected eggs were cultured in E3 + PTU media. Before injection at 2 dpf, the embryos were dechorionated, anesthetized, and mounted in low-melting point agarose. Tumor cells were injected into the common cardinal vein at 2 days postfertilization (dpf). After injection, the embryos were released from the agarose and cultured in a 33 °C incubator in E3 + PTU supplemented with penicillin‒streptomycin. At 1 day postinjection (dpi), the embryos were anesthetized, placed in a 96-well plate (1 embryo/well), and imaged using a Nikon Eclipse Ti2 wide-field microscope. After imaging, the anesthetic was removed, and the embryos were cultured at 33 °C until imaging at 3 dpi. The number of extravasated (1 dpi) and survived (3 dpi) disseminated tumor cells (DTCs) was counted manually using QuPath (version 0.4.4). DTCs were counted separately for the brain, defined as the anatomical region situated anterior to both the pericardiac cavity and the otic vesicle, and for the body (all remaining anatomical structures). The samples were blinded during the image analysis.

In vivo mouse experiments

Intracardial injection into the left ventricle of five 9-week-old nude mice (NMRI-Foxn1nu; Jackson Laboratories, US) per group was performed using 5*105 A549-luciferase or A549-HERC5-KO-luciferase cells in 100 μL of 0.9% NaCl solution. Photon emission was measured after injection of 3 mg D-luciferin (Biosynth Carbosynth, UK) per mouse and incubation for 10 min (BLI). Mice were euthanized after 31 days. X-ray analysis of the whole mouse skeleton was performed, and blood and bone marrow samples were purified and stained by using immunofluorescence. Brain and adrenal gland tissues were formalin-fixed and paraffin-embedded (FFPE).

Enrichment and detection of circulating tumor cells (CTCs) and DTCs from blood and bone marrow samples

Retrobulbar blood samples from each mouse cohort were pooled and processed with a size-based separation system (Parsortix™ Cell Separation System Angle plc, UK) for isolation of CTCs using 6.5 μm cassettes. Bone marrow was isolated from the femurs and tibias of the mice after mechanical cleaning of the muscles and other tissues and by opening on one side and placing the bones upside down in a reaction tube. After the addition of 10 μL of PBS, the bone marrow was flushed by centrifugation at 8000 × g for 30 s. After centrifugation at 16,000 × g for 10 min, the pellet was resuspended in 500 μL of 1 × Flow Cytometry Human Lyse Buffer (R&D Systems, US) and incubated for 3 min. PBS was added, and the mixture was centrifuged again at 16,000 × g for 10 min. The supernatant containing the PBMCs and DTCs was diluted in PBS and cytocentrifuged on SuperFrost® microscope slides (R. Langenbrinck GmbH, DE). CTCs and DTCs were detected by immunofluorescence staining using mouse CD45-APC (1:150; BD Pharmingen, US; 30-F11), pancytokeratin (1:200; Invitrogen, US; AE1/AE3-al570), and pankeratin (1:200; Cell Signaling, US; C11-al555) as described previously [33].

Analysis of tumor spread in mice

The brain tissue was cut coronally into five slices, while the adrenal glands remained in one piece. The FFPE embedded organs were cut into 5 μm thin slices, and after deparaffinization, antigen retrieval products (BioGenex Citrate Buffer, pH 6; Thermo Fisher Scientific, US) and antibodies (Keratin AE3; EMD Millipore, DE; MAB1611 and keratin AE1; EMD Millipore, DE; MAB1612, both 1:1000) were diluted with Antibody Diluent DAKO incubated overnight in a humidified chamber at 4 °C and detected with a DAKO REAL Detection System (Agilent Technologies, US) according to the manufacturer’s protocol. The tumor volume of the brain and of the adrenal gland metastases were calculated by the following formula modified from Kunkel et al. [34]: \(Tumor\;volume=\left[\sqrt[2]\right]^3\).

For analysis of brain metastases, every 10th slice was analyzed, corresponding to an interval of 50 μm.

Mass spectrometry analysis

The cell pellets from untreated and treated (IFNγ (10 ng/ml; PeproTech, US) and TNFα (50 ng/ml; PeproTech, US) for 48 h) cells were resuspended in 500 μL of 0.1% TEAB/1% SDC for cell lysis and heated for 5 min at 95 °C. The samples were sonicated (6 pulses at 30%) using a sonication probe, and the protein concentration was analyzed (see Western Blotting). 20 μg of protein was tryptically digested in 100 μL of 0.1% TEAB/1% SDC, and disulfide bridges were reduced by 10 mM dithiotreithol for 30 min at 60 °C. After incubation with 20 mM iodacetamide for 30 min at 37 °C in the dark for alkylation of thiol groups, proteolytic cleavage after arginine and lysine residues was performed using a trypsin:protein ratio of 1:100 (37 °C overnight). SDC was removed by precipitation with 1% acetic acid, and the remaining supernatant was lyophilized using a SpeedVac vacuum concentrator and resuspended in 0.1% FA to a final concentration of 1 mg/mL. 1 μg of protein was injected into a Dionex Ultimate 3000 UPLC system. Peptides were purified and desalted using an Acclaim PepMap 100 C18 trap (100 μm × 2 cm, 100 Å pore size, 5 μm particle size) precolumn (Thermo Fisher Scientific, US) and transferred to an Acclaim PepMap 100 C18 analytical column (75 μm × 50 cm, 100 Å pore size, 2 μm particle size; Thermo Fisher Scientific, US) for chromatographic separation. The eluting peptides were subsequently transferred into a Quandrupole-Iontrap-Orbitrap tribrid mass spectrometer (Orbitrap Fusion, Thermo Fisher Scientific, US) and analyzed via a label-free DDA LC‒MS2 approach using an Orbitrap mass analyzer at the MS1 and an ion trap mass analyzer at the MS2 level. The mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE [35] partner repository with the provisional dataset identifier PXD045563. The resulting mass spectra were searched against a reviewed human FASTA database (Swissprot) containing 20,365 entries downloaded in October 2020 using MaxQuant version 1.6.2. The carbamidomethylation of cysteine residues was set as a fixed modification. The oxidation of methionine was included as a variable modification. Matching between runs was included to increase the number of identified peptides in each sample. LFQ intensities were used for quantitative analysis via PERSEUS version 1.5.8.5., log2-transformed and median-normalized across columns.

Significantly differentially abundant proteins were identified using a two-sample Student’s t test. Proteins that had a p value < 0.05 and an additional fold change cutoff > 1.5 were considered to be significantly differentially abundant across groups.

In Silico validation

For external validation of our findings publicly available proteome data of 141 lung cancer patients from Lehtiö et al. (2021) [36], accessible via PRIDE (PXD020548) was used. The preprocessed DDA data with a threshold of 0.5 and -0.5 was used to stratify patients in a HERC5 high (n = 24) and a HERC5 low (n = 14) group based on normalized HERC5 abundance exceeding a threshold of 0.5 (high) or -0.5 (low). As in the cell line data, significantly differential abundant proteins were identified using an unpaired Students T-Test. Proteins with a p – value < 0.05 and fold-change > 1.5 or <—1.5 were considered as significantly differential abundant across the two groups.

GO term analysis and GO term enrichment analysis

Gene ontology plots were generated according to Bonnot et al. [37], here displaying the top 5 significant (FDR < 0.05) enriched GO terms. Using this list, the corresponding genes that make up the GO biological processes were visualized using the R package GOplot according to Walter et al. [38]. EnrichR [39] was used for the pathway enrichment analyses of the validation cohort using the GO Biological Process and GO Molecular Function databases and a ranking based on the calculated p-value.

Electron microscopy imaging

For EM imaging, A546 PAR/KO and HTB56 EC/OE cell lines were cultivated in T75 flasks, trypsinized, and resuspended in 1 ml of 4% PFA plus 1% glutaraldehyde (Roth, DE) in 0.1 M PBS. The cells were fixed at RT for 1 h and subsequently at 4 °C overnight in the same fixative. After centrifugation, the resulting pellets were contrasted in 0.5% osmium tetroxide (30 min at RT), dehydrated, and embedded in epoxy resin (Durcupan, Sigma‒Aldrich, UK). Images were taken using a Philips CM100 transmission electron microscope. For quantification, random images of 22–31 cells per condition were taken and analyzed for mitochondrial density per cytoplasmatic area. Moreover, we measured mitochondrial size (338–581 mitochondria per condition) using the same set of random images. For the measurements, we used ImageJ software.

NAD/NADH Glo-assay

The NAD/NADH-Glo™ Assay (Promega, US) was performed according to the manufacturer’s instructions. After the calculation of the NAD/NADH ratios, a two-sided Student’s t test was used to determine the significance of the differences between the cell lines.

Seahorse XF assays

A549 PAR/KO or HTB56 EC/OE cells were plated in 96-well cell culture microplates (XFe96, Agilent Technologies, US) at a density of 10,000 cells per well. On the day of measurement, the cells were incubated for 1 h in bicarbonate-free DMEM containing 5 mM HEPES, 10 mM glucose, 1 mM pyruvate, and 2 mM glutamine. Oxygen consumption and extracellular acidification rates (OCR and ECAR) were measured simultaneously using a Seahorse XFe96 Flux Analyzer (Cell Mito Stress Test Kit and Glycolytic Rate Assay Kit, Agilent Technologies, US) according to the manufacturer’s instructions. ATP-dependent respiration was profiled by injecting 1.5 μM oligomycin (which inhibits ATP synthase), and the full substrate oxidation capacity was determined by injecting either 1.5 µM (A549 cells) or 0.75 µM (HTB56 cells) carbonylcyanide-p-trifluoromethoxyphenylhydrazone (FCCP, a chemical uncoupler). Nonmitochondrial respiration was determined by injecting 0.5 μM antimycin A and 0.5 μM rotenone (which inhibit electron flux through complexes I and III). Additionally, conducting the Glycolytic Rate Assay, basal glycolysis was measured followed by measuring the compensatory glycolysis by injecting 0.5 μM antimycin A and 0.5 μM rotenone. Finally, glycolysis was inhibited to confirm the experimental setup by injecting 50 mM 2-deoxy-glucose (2-DG, a glucose analog). OCRs and ECARs were determined by machine learning algorithms and plotted against time. The values were normalized to the DNA content by Quant-iT picoGreen staining (Thermo Fisher Scientific, US) for the Mito Stress Test and nuclei count determined by DAPI signal after fixation with 4% PFA and staining with 1 µg/mL DAPI using CellProfiler (version 4.2.6) [40] for Glycolytic Rate Assay. Relative ATP production rates were calculated from the OCR and ECAR rates assuming a P/O ratio of 2.75.

Lactate assays

Lactate secretion by A549 cells during long-term oligomycin treatment was assessed with a Lactate-Glo™ Assay (Promega, US). The supernatants from eight biological replicates of the methylene blue proliferation assay were collected, and a lactate assay was performed according to the manufacturer’s instructions. The samples were diluted 1:500 in PBS. The reaction mixture was downscaled to 50 µL per reaction, and luminescence was measured in duplicate using a plate reader (GloMax Discover, Promega, US).

Statistical analyses

All the experiments were performed using at least three independent biological replicates unless otherwise indicated. Statistical testing was performed using Student’s t test, one-sample t test, paired t test, Wilcoxon one-sample signed rank test, or Mann‒Whitney U test. The results were considered significant when the obtained p values were less than 0.05 (*). Significance values were obtained using Excel (Microsoft Office Professional 2013 Plus), R (version 4.0.3), R Studio (version 1.1.423), or GraphPad Prism (version 9.4.1).