Cell lines and viruses

HCT116, BHK21 and Vero E6 cells were maintained at 37 °C in a humidified atmosphere containing 5% CO2 and cultured in Dulbecco’s Modified Eagle medium (DMEM; Invitrogen) supplemented with 10% FBS. Viral stocks were prepared from infectious clones (kindly provided by Dr Carla Saleh, Institut Pasteur, Paris, France) carrying either the wild-type or a GFP containing version of the SINV genomic sequence as previously described [29]. Briefly, the plasmids were linearized by XhoI digestion and used as a substrate for in vitro transcription using the mMESSAGE mMACHINE capped RNA transcription kit (Ambion, Thermo Fisher Scientific Inc.). In vitro synthesized viral RNA was transfected in BHK21 cells, viral infectious particles were collected 48 hpt and used to infect BHK21 for the full viral production. Titers were measured by standard plaque assay in Vero E6 cells. Cells were infected at a MOI of 1, 10−1 or 10−2 as indicated in the figure legends.

Plaque assay

For plaque assay, 1 million Vero E6 cells were seeded in a 96 well plate and infected for 1 h with viral supernatants prepared in 10-fold dilution cascade. After removal of the viral inoculum, 2.5% carboxymethyl cellulose diluted in DMEM-FBS10% was added and cells were incubated at 37ºC in a humidified atmosphere of 5% CO2. Plaques were counted manually under the microscope after 72 h.

DDX5 CRISPR/Cas9 knockout

Guide RNA (gRNA) sequences targeting the human DDX5 gene were designed using the CRISPOR tool (http://crispor.tefor.net) and cloned into the pX459-V2 vector (Addgene Plasmid #62988 was a gift from Feng Zhang [30]). Briefly 0.25 µM of the annealed oligos and 100 ng of digested vector were ligated and transformed into DH5 alpha cells.

guideRNA#2 DDX5 sense: 5’ CACCGATAATAGGGTGTTCATAGGT 3’

guideRNA#2 DDX5 antisense: 5’ AAACACCTATGAACACCCTATTATC 3’

guideRNA#1 DDX5 sense: 5’ CACCGCCCTACTTCCTCCAAATCG 3’

guideRNA#1 DDX5 antisense: 5’ AAACCGATTTGGAGGAAGTAGGGC 3’

HCT116 cells were transfected with 2 plasmids containing the sequence of gRNA#1 and #2, respectively. Twenty-four hours post-transfection, cells were treated with 1 µg/mL puromycin for 48 h. Surviving cells were diluted to obtain 0.5 cell/ well in 96 well plates. Two weeks later, cellular genomic DNA was extracted from individual colonies. Cells were lysed in genomic DNA extraction buffer (50 mM Tris-HCl [pH 8.0]; 100 mM EDTA [pH 8.0], 100 mM NaCl, 1% SDS) containing 0.1 mg of proteinase K and incubated overnight at 55°C. Then, 50 ng of genomic DNA were amplified with the GoTaq DNA Polymerase (Promega) using specific primers (IDT) to detect the deletion (DDX5 FW: 5’-ATAAATCCCCGGCTTCCGAC-3’; DDX5 RV: 5’-AGAGGGGGTAGGTGGAAACAA-3’). Wild type genomic DNA was used as control template. PCR reactions were loaded on a 1% agarose gel and the obtained amplicons were gel purified and sequenced by Sanger sequencing.

SiRNA-based knockdown

For the knockdown experiments, 0.6 million of HCT116 cells were reverse-transfected with 20nM of ON-TARGETplus Human siRNAs (Horizon) against DDX5 (L-003774-00-0005), DDX17 (L-013450-01-0005) or non-targeting Control Pool (D-001810-10-05) using the Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, #11668019) according to the manufacturer’s instructions in 6 well plates. After 24 h, cells were transfected again with 20nM of the same mix of siRNAs and incubated overnight. Cells were then infected with SINV-GFP at a MOI of 0.1 for 24 h. Supernatant were collected for plaque assay experiment and proteins and RNA were collected for western blot and RT-qPCR analyses, respectively.

Lentivirus production and generation of stable cell lines

Lentiviral particles were produced by transfecting seven million of HEK293T cells with 12 µg of either pLV-DDX5-V5 or pLV-BFP viral vector (Vector Builder), 2.4 µg and 9.6 µg of the packaging plasmids pCMV-VSV-G (Addgene #8454) and psPAX2 (Addgene #12260) respectively, using Lipofectamine 2000 reagent (Invitrogen, Fisher Scientific) according to the manufacturer’s protocol. The viral supernatants were collected after 48 h and filtered using a 0.45 μm PES filter.

DDX5 KO HCT116 cells were transduced in 6-well plates using the lentiviral supernatant diluted in fresh medium supplemented with 4 µg/mL of polybrene (Merck, Sigma-Aldrich). The medium was changed after 8 h and the selection with the appropriate antibiotic was initiated after 48 h. Polyclonal V5-DDX5-DDX5 KO HCT116 (V5-DDX5) and BFP-DDX5 KO HCT116 (BFP) cells were maintained under selection for a minimum of 10 days before analysis. In detail, two-hundred thousand of V5-DDX5 or BFP-DDX5 stable cells were infected with SINV-GFP for 24 h (MOI of 0.1). before collecting the supernatant for plaque assay experiment, as well as proteins and RNA for western blot and RT-qPCR analyses, respectively.

Live-cell imaging

Two-hundred thousand WT, DDX5 KO, BFP or V5-DDX5- HCT116 cells were seeded in 12 well plate and infected with SINV-GFP at the indicated MOI. Uninfected cells were used as control. GFP fluorescence and phase contrast were observed using a CellcyteX live-cell imaging system (Discover Echo). Four to six images per well (10X objective) were acquired every 3–6 h for 72 h and were analysed with the Cellcyte Studio software to determine cell confluency and GFP relative intensity.

Cloning

Amplicons containing the coding sequence for the individual viral proteins were generated by PCR from the plasmid carrying the SINV genomic sequence (kindly provided by Dr. Carla Saleh, Institut Pasteur, Paris, France) and cloned into the pDONR221 vector (Invitrogen) by recombination using the Gateway BP clonase (Invitrogen) according to the manufacturer instructions. The pDEST-FLAG-HA- nsP1, pDEST-FLAG-HA- nsP2, pDEST-FLAG-HA- nsP3, pDEST-FLAG-HA- nsP4 and pDEST-FLAG-HA- capsid vectors were obtained by recombination using Gateway LR clonase (Invitrogen) in the pDEST- FLAG-HA vector according to the manufacturer instructions, as in [31]. Primers used for the PCR are listed below:

pDONR NSP1 FW

5’ GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGAAGCCAGTAGTAAAC-3’

pDONR NSP1 REV

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATTTGCTCCGATGTCCG-3’

pDONR NSP2 FW

5’GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGCATTAGTTGAAACCCCG-3’

pDONR NSP2 REV

5’GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATTGGCTCCAACTCCATCTC-3’

pDONR NSP3 FW

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGCGCCGTCATACCGCACC-3’

pDONR NSP3 REV

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATTGTATTCAGTCCTCC-3’

pDONR NSP4 FW

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTAACCGGGGTAGGTGGGTAC 3’

pDONR NSP4 REV

5’GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTATTTAGGACCACCGTAGAG-3’

pDONR capsid FW

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAATAGAGGATTCTTTAAC-3’

pDONR capsid REV

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTATTCCACTCTTCTGTCC-3’

Flag-HA SINV protein co-IP

For the experiment, 0.6 million of HCT 116 cells were seeded in 6 well plates. The following day 3 µg of the pDEST-FLAG-HAdescribed above were transfected using the Lipofectamine 2000 transfection reagent as per manufacturer’s recommendations. 48 h later, the cells were washed once with 1x PBS and lysed in 600 µL of Miltenyi lysate buffer (50 mM Tris-HCl pH 7.5, 140 mM NaCl, 1.5 mM MgCl2, 0.1% NP-40), supplemented with Complete-EDTA-free Protease Inhibitor Cocktail (Merck). Cells were lysed for 30 min incubation on ice and debris were removed by 10 min centrifugation at 10000 g at 4 °C. An aliquot of the cleared lysates (50 µL) was kept aside as protein Input. Samples were divided into equal parts (250 µL each) and incubated with 50 µL of magnetic microparticles coated with monoclonal HA or MYC antibodies (MACS purification system, Miltenyi Biotec) at 4 °C for 1 h under rotation (10 rpm). Samples were passed through µ Columns (MACS purification system, Miltenyi Biotec). The µ Columns were then washed 4 times with 200 µL of WASH buffer1 and 1 time with 200 µL of WASH buffer 2. To elute the immunoprecipitated proteins, 70 µL of 95 °C pre-warmed 2x Western blot loading buffer (10% glycerol, 4% SDS, 62.5 mM Tris-HCl pH 6.8, 5% (v/v) 2-β-mercaptoethanol, Bromophenol Blue) was passed through the µ Columns. Proteins were analysed by western blotting.

DDX5 and DDX17 co-immunoprecipitation and RNA immunoprecipitation

DDX5 and DDX17 immunoprecipitations (IP) were performed as in [26] with some modifications. Briefly, 4 million of mock or SINV-GFP infected HCT116 cells (MOI 0.1, 24 hpi) were lysed using RIP immunoprecipitation buffer (50 mM tris-HCL [pH 7.5], 150mM NaCl, 5 mM EDTA, 0.05% SDS, 1% triton, 1 tablet of commercial protease inhibitor cocktail (Merck)). RNase treatment was performed on the lysates by adding 1 µL of RNase A at 10 mg/mL (Thermo Fisher) and incubating for 25 min at 37 °C. DNase treatment was performed on the lysates by adding 1 µL of RNase-free DNase I at 1 U/µL (Thermo Fisher Scientific), 10 mM MgCl2, 5 mM Cacl2 and 1 µL of Ribolock (Thermo Fisher Scientific) to the 1 mL lysate and incubating for 20 min at 37 °C. Lysates were centrifuged for 10 min at 4 °C. Supernatants were collected and pre-cleared for 1 h at room temperature with Dynabeads protein G magnetics beads (Invitrogen) blocked with yeast tRNA (Invitrogen). The efficiency of the RNase treatment was evaluated by RNA analysis of the input samples on a 1% agarose gel.

Lysates were incubated over night at 4 °C with 40 µL of Dynabeads protein G beads conjugated with 2 µg rabbit anti-DDX5 antibody (ab21696; Abcam), or rabbit anti-DDX17 antibody (19910-1-AP, Proteintech) or 2 µg rabbit IgG antibody (2729; Cell Signaling Technology).

Beads were washed 3 times with RIP buffer containing 150mM NaCl, twice with the same buffer supplemented with 50mM of NaCl, and 3 times with RIP buffer containing 150mM NaCl. 30% of the immunoprecipitated protein and 70% of the associated RNA were eluted with Laemmli 1X at 95 °C for 10 min or with 1 mL TriReagent (Thermo Fisher Scientific), respectively. Proteins were analysed by western blot or by mass spectrometry, while RNA was extracted and analysed by RT-qPCR.

Western blot

Cells were collected in 300 to 500 µL of lysis buffer (50mM tris-HCL [pH 7.5], 150mM NaCl, 5 mM EDTA, 0.05% SDS, 1% triton, 1 tablet of commercial protease inhibitor cocktail (ROCHE)) and incubated for 30 min on ice. Cell lysates were then collected and protein concentration was determined using the Bradford method (Bio-Rad). For total protein analysis, 20 µg of protein samples were heated in 1X Laemmli buffer at 95 °C for 5 min and loaded on pre-cast 4–20% SDS-polyacrylamide electrophoresis gel (Bio-Rad). For the RIP experiment, 0.5% of input and 12,5% of immunoprecipitated protein were used. After migration, the proteins were transferred onto 0.45 μm nitrocellulose membranes (GE healthcare). The membranes were blocked with 5% non-fat milk diluted in PBS 1X (Euromedex) complemented with 0.2% Tween-20 (PBS-T) for 1 h at room temperature and then were incubated at 4 °C overnight or 1 h at room temperature with the following specific primary antibodies: anti- DDX5 (mouse- horseradish peroxidase(HRP), sc-365164; Santa Cruz Biotechnology) or anti-DDX5 (rabbit, ab21696; Abcam), anti-DDX17 (mouse, sc-271112; Santa Cruz Biotechnology), anti-tubulin HRP (mouse, ab21058; Abcam), anti-GAPDH-HRP (mouse, ab9482; Abcam), anti-capsid (rabbit, kind gift of Diane Griffin), anti-GFP (mouse, 11814460001, Roche). Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V, Merck) secondary antibodies for 1 h at room temperature. Proteins were detected using the Chemiluminescence substrate (Supersignal West Pico; Pierce) and analysed with the Fusion FX imaging system (Vilber).

RNA extraction and RT-qPCR

Total RNA and RNA enriched upon specific protein immunoprecipitation (RIP) were extracted using TriReagent (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions. For total RNA analysis, 1 µg of RNA was reverse transcribed with the SuperScript VILO Master Mix (Invitrogen, Thermo Fisher Scientific) according to the manufacturer’s instructions. For the RIP experiment, 1 µL of samples before and after IP was used for retro-transcription using the same protocol. RT-qPCR was performed on cDNA using the Maxima SYBR Green qPCR Master Mix K0253; Thermo Fisher Scientific) on the CFX96 touch Real-Time PCR machine (Bio-Rad) using the following primers at an annealing temperature of 60 °C:

SINV genome FW: `

5′-CCACTACGCAAGCAGAGACG-3′;

SINV genome RV:

5′-AGTGCCCAGGGCCTGTGTCCG-3′;

GAPDH FW:

5′-CTTTGGTATCGTGGAAGGACT-3′;

GAPDH RV:

5′-CCAGTGAGCTTCCCGTTCAG-3’

SINV sub-genome-genome FW

5’CCACAGATACCGTATAAGGCA 3’

SINV sub-genome-genome RV

5’ TGCAGGTAATGTACTCTTGG 3’

Immunostaining

Mock or SINV WT- infected cells were plated on 8-well LabTek slide (Merck Millipore), were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X. Cells were blocked in blocking buffer (0.1% Triton X-100; PBS 1 X; 5% normal goat serum) for 1 h. The following primary antibodies were diluted 1:400 in blocking buffer and incubated over night at 4 °C: mouse anti-dsRNA J2 (RNT-SCI-10010200; Jena bioscience), mouse anti-DDX5 (67025 Proteintech) or rabbit anti-DDX5 (ab21696; Abcam), anti-DDX17 (mouse, sc-27112; Santa Cruz Biotechnology), anti-capsid (rabbit, kind gift of Diane Griffin). Cells were washed with PBS 1X-Triton 0.1%. and incubated for 1 h at room temperature with goat anti-mouse Alexa 594 (A11032, Invitrogen) or goat anti-rabbit Alexa 488 (A11008, Invitrogen) secondary antibodiesdiluted at 1:1000 in PBS 1X-Triton X-100 0.1%. DAPI staining was performed for 5 min in PBS 1X to reveal the nuclei (D1306, Invitrogen, Thermo Fisher Scientific). Slides were mounted on coverslips with Fluoromount-G mounting media (Invitrogen, Thermo Fisher Scientific) and observed by confocal microscopy (LSM780, Zeiss) with a 40X or 63X objective. Images were analysed using Image J software and fluorescence intensity profiles were obtained.

Sequential immunostaining and FISH

Mock or SINV-WT infected (MOI 1, 24hpi) HCT116 cells were grown on 18 mm round cover glass in 12-well cell culture plates.

Cells were fixed with 3.7% formaldehyde diluted in PBS 1X for 10 min at room temperature. Cells were then permeabilized in 1 mL of 0.1% Triton X-100 in 1X PBS for 5 min at room temperature and incubated with anti-DDX5 primary antibody (rabbit, ab21696; Abcam) diluted to 1:400 in PBS 1X for 1 h. Goat anti-rabbit Alexa 488 (A11008, Invitrogen) secondary antibody diluted to 1:1000 was added on the cells for 1 h at room temperature.

Cells were fixed again with 3.7% formaldehyde (Biosearch technologies) diluted in PBS 1X for 10 min at room temperature and incubated over night at room temperature with the SINV genome specific LGC Biosearch Technologies’ Stellaris® RNA FISH Probe diluted in RNA FISH hybridization buffer (Stellaris, Biosearch technologies). DAPI staining was performed for 30 min to reveal the nuclei (D1306, Invitrogen, Thermo Fisher Scientific). Slides were mounted on coverslips with Fluoromount-G mounting anti-fading media (Invitrogen, Thermo Fisher Scientific) and observed by confocal microscopy (LSM780, Zeiss). Images were analysed using Image J software.

Mass spectrometry analyses

For LC-MS/MS analyses, proteins were prepared as described in a previous study [26]. Proteins eluted from the beads were washed with 2 sequential overnight precipitations with glacial 0.1 M ammonium acetate in 100% methanol (5 volumes) followed by 3 washes with glacial 0.1 M ammonium acetate in 80% methanol. Proteins were then solubilized in 50 mM ammonium bicarbonate for a reduction-alkylation step (dithiothreitol 5 mM – iodoacetamide 10 mM) and an overnight digestion with 300 ng of sequencing-grade porcine trypsin (Promega, Fitchburg, MA, USA). Digested peptides were resuspended in 0.1% formic acid (solvent A) and injected on an Easy-nanoLC-1000 system coupled to a Q-Exactive Plus mass spectrometer (Thermo Fisher Scientific, Germany). One fourth of each sample was loaded on a C-18 precolumn (75 μm ID × 20 mm nanoViper, 3 μm Acclaim PepMap; Thermo-Fisher Scientific) and separated on an analytical C18 analytical column (75 μm ID × 25 cm nanoViper, 3 μm Acclaim PepMap) with a 160 min gradient of solvent B (0.1% of formic acid in acetonitrile).

Qexactive data were searched with Mascot algorithm (version 2.6.2, Matrix Science) against the Swissprot database with H. sapiens taxonomy (release 2020_05) as well as the sequences of GFP and of SINV virus (20 394 sequences) with a decoy strategy. The resulting .dat Mascot files were then imported into Proline v2.0 software [32] to align the identified proteins. Proteins were then validated on Mascot pretty rank equal to 1, 1% FDR on both peptide spectrum matches (PSM) and protein sets (based on Mascot score).

For statistical analyses of the mass spectrometry data, spectral counts (SpC) of the identified proteins were stored in a local MongoDB database and subsequently analysed through a Shiny Application built upon the R packages msmsEDA (Gregori J, Sanchez A, Villanueva J (2014). msmsEDA: Exploratory Data Analysis of LC-MS/MS data by spectral counts. R/Bioconductor package version 1.22.0) and msmsTests (Gregori J, Sanchez A, Villanueva J (2013). msmsTests: LC-MS/MS Differential Expression Tests. R/Bioconductor package version 1.22.0). Differential expression tests were performed using a negative binomial regression model. The P-values were adjusted with FDR control by the Benjamini–Hochberg method and the following criteria were used to define differentially expressed proteins: an adjusted P-value < 0.05, a minimum of 5 SpC in the most abundant condition, and a minimum absolute Log2 fold change of 1.

Statistical analysis

Statistical analyses were performed using GraphPad Prism 9 software. Generally, a paired Student’s t test was performed for comparisons between two samples for plaque assays and a one-sample t test was performed to determine the significance of the fold change on qPCR results in which the control sample was set to 1. The number of replicates per experiment and the specific statistical tests used are stated in the figure legends.