Animals and anesthesia

Cell-type-specific HO-1 knockout in myeloid cells including microglia (LyzMCre-Hmox1fl/fl) was achieved by crossing Hmox1fl/fl mice (Riken Bio Resource Center, RBRC03163) with mice expressing Cre recombinase under the lysozyme (Lyz) promoter (Jackson Laboratory, #004781). Hmox1fl/fl microglia were used as controls for all in vitro studies. Animals were fed with a standard rodent diet ad libitum while kept on a 12-h light/12-h dark cycle. All types of surgery and manipulations were performed under general anesthesia with ketamine (100 mg/kg) and xylazine (5 mg/kg) and body temperature maintenance. After surgery, buprenorphine (50 µg/kg) was applied subcutaneously to treat possible pain.

Subarachnoid hemorrhage (SAH) model

SAH was achieved by pre-chiasmatic injection of blood withdrawn from the hearts of donor mice. Only male mice were used for the SAH treated mouse group as well as the donor mice.After induction of anesthesia, the head was fixed in a stereotactic frame. The anterior skull was exposed with a midline skin incision. 3.5 mm anterior to the bregma, a 0.8 mm burr hole was drilled into the skull with a caudal angle of 40°. A 27-G needle was advanced through the burr hole at a 40° angle until the base of the skull was reached, then 40 µl of whole blood was slowly injected and the needle left in place for 1 min to avoid backflow. After observing for overt bleeding, the skin was sutured, and animals were allowed to emerge from anesthesia under close supervision with body temperature maintenance using infrared light. The mice were treated with buprenorphine (50 µg/kg) three times a day for the first three days postoperatively. SAH was either induced at ZT2 or ZT12, which corresponds to the end of the 2nd and the 12th hour of the 12-hour light cycle. We chose ZT2 and ZT12 as the time points of SAH because these correspond to the nadir and peak within the circadian gene expression profile.

CO gas treatment

After SAH, animals were randomly assigned to either receive treatment with CO or air for 1 h. CO exposure was done in a custom-made chamber. Animals had free access to food and water during the treatment. Pre-mixed air with 250 ppm CO was used. Treatment was started immediately after the SAH and repeated every 24 h for 1 to 7 days, depending on the specified readouts.

Barnes maze behavioral studies

Spatial learning was tested on the Barnes maze. In brief, the paradigm consisted of a white circular platform with a diameter of 120 cm and 40 equal-sized holes along the perimeter. Beneath one hole, a box into which the animals could escape from the open platform was positioned. As an aversive stimulus to leave the platform, a bright light source was placed above the setup. A rewarding stimulus was implemented by placing food pellets into the escape box. Cardboard symbols with different visual cues were placed around the platform as orientation marks. During the initial acquisition period, the location of the escape box and the visual cues were kept constant. The mice underwent initial spatial acquisition for 7 days with 3 trials per animal per day. A maximum of 3 min for exploration of the maze was allowed per animal. Thorough cleaning of the platform after each animal to eliminate olfactory cues was performed. Animals who failed to enter the escape box within 3 min were guided to the correct hole. The total time required for the mouse to find the goal box (latency) and the number of holes the animal explored before finding the goal box (error number) were measured as surrogates for cognitive function. SAH was induced after 7 days of acquisition. Spatial memory testing consisted of 1 trial per animal per day starting on day 1 after SAH until day 7 after SAH. To test for flexibility and relearning, the location of the goal box was changed to the exact opposite position on day 4 (spatial reversal) with all visual cues kept constant. Therefore, relative latency times in the Barnes maze spatial memory paradigm for functional outcome in the results from day 14 were measured 6 days after SAH induction and 2 days after spatial reversal.

Hematoxylin/eosin staining and evaluation of cerebral vasospasm

7 days after SAH, animals were deeply anesthetized with ketamine and xylazine and transcardially perfused with TBS followed by PFA 4%. Brains were removed and fixed in PFA 4% for 18 h. After cryoprotection in sucrose, brains were frozen, cut into 8 μm sections and stained with hematoxylin and eosin. Representative digital images of 2–3 consecutive middle-cerebral artery (MCA) cross-sections from each animal were obtained and the lumen radius/wall thickness ratio was quantified to assess vasospasm using Image J. The outer and inner vascular circumferences were measured with Image J. The vasospasm index was calculated by inner circumference divided by de difference of outer circumference minus inner circumference.

Immunohistochemistry

Frozen brains were cut into 8 μm serial coronal sections. The glass slides with brain sections were heated in 1x citrate buffer pH 6 (Zytomed System GmbH, K035) in a microwave (3 × 5 min 800 W). Permeabilization was done with 0.1% Triton/PBS for 10 min at room temperature (Iba-1) or with 0.2% Tween/PBS for 10 min at room temperature (TER-119 co-staining with Iba-1). Slides were then blocked in 10% donkey serum/PBS (Iba-1 or 4% BSA/PBS (TER-119 co-staining with Iba-1) for 1 h at room temperature. Staining was performed with primary antibodies against Iba-1 (Abcam AB5076, 1:200) or against TER-119 (Abcam AB91113, 1:100) with Iba-1 at 4 °C overnight. Sections were then conjugated with the corresponding secondary antibody for fluorescent imaging (for Iba-1 anti-goat Alexa Fluor 488, Abcam AB150129 and for TER-119 anti-rat Alexa Fluor 555, Abcam AB150154; 1:300). Nuclear counterstain was done with DAPI and slides were examined under a fluorescence microscope (Zeiss AxioObserver Invert). To achieve appropriate consistency in the quantification of cells, from each area of interest, 2–4 images were obtained of 3–4 mice per group. For analysis of microglia phagocyting erythrocytes, cells with colocalization of TER-119 and Iba-1 were counted. Activated microglia are characterized by larger cell bodies with retracted extensions while resting microglia show smaller cell bodies with extended ramifications. Therefore, we measured the soma size of Iba-1 positive microglia in coronal brain sections and used the mean of soma sizes as a hallmark of activation by area with ZEN 2.5 (blue edition) software from Carl Zeiss Microscopy. For representation in the figures, larger analyzed images were cropped down to one representative area, cell or vessel per group.

BV-2 and PMG cell culture and treatment

The feasibility of circadian studies in vitro has been shown before with robust in vitro expression of genes relevant to circadian control and the possibility of inducing these genes via various stimuli [29]. Circadian rhythm can be restored with adequate entrainment stimuli such as medium change [29]. Therefore, experiments were performed 2 and 12 h after the medium change. Matching resulting gene expression profiles with profiles from prior research resulted in the identification of an early and late phase of the circadian cycle [30, 31]. Early and late phases in vitro are corresponding to ZT2 and ZT12 in vivo.

BV-2 microglia cells were incubated in DMEM containing 1% penicillin-streptomycin and 10% FBS in a humidified atmosphere with 5% CO2. Cells were seeded into 6-well plates (western blot analysis) or 24-well plates (other experiments) at a density of 200,000 for individual experiments. PMG were isolated from LyzM-Cre-Hmox1fl/fl or Hmox1fl/fl mice at P5 to P7 (50% female and 50% male) by enzymatic neural dissociation (Papain Neural Dissociation Kit; Miltenyi Biotec) and in vitro mixed glia culture. Mouse brains were enzymatically dissociated according to the manufacturer’s instructions and the resulting mixed glia culture containing astrocytes and microglia was cultivated in DMEM containing 1% penicillin-streptomycin, 10% FBS, and M-CSF (10 ng/ml) in a humidified atmosphere with 5% CO2. After one full medium change and 1 week of cultivation, microglia were collected by shaking the cell culture plates at 200 rpm for 30 min every 2 to 3 days. Floating microglia were collected from the supernatant and seeded onto 24-well plates for experiments at a density of 2 × 105 cells per well. The microglial phenotype was confirmed by CD11b staining and flow cytometry (99,5% positive).

Flow cytometry

Cells were harvested with a cell lifter, washed with flow cytometry buffer (PBS w/1% BSA, 2mM EDTA, 0.05% Na-Azide) and incubated with CD16/32 antibodies to block unspecific Fc-binding loci. Specific staining was performed with a PE-Cy7-tagged CD11b antibody (Biolegend, 1:100, 30 min). Flow cytometry was done on a FACS LSR Frida (B&D Biosciences) with a selection of CD11b positive PMG and detection of phagocytosis-related fluorescence in FL-1. The relative % of RBC-positive PMG and the mean fluorescence per PMG was calculated using FlowJo.

Western blot analysis

Cells were washed with PBS and lysed in radioimmunoprecipitation assay (RIPA) buffer with PhosStop (Sigma Aldrich 4,906,845,001) and protease inhibitor (Sigma Aldrich 4,693,116,001) shaking at 1000 rpm for 10 min at 4 °C. Equal amounts of protein (50 µg) were separated on a 10% SDS (Sigma-Aldrich R0278) polyacrylamide gel (TGX Stain-Free™ FastCast™ 161–0183 Bio-Rad) and transferred to a polyvinylidene difluoride (PVDF) membrane (Trans Blot Turbo Transfer Pack 1,704,157 Bio-Rad) with a Trans Blot Turbo Transfer System (Bio-Rad). Pictures of the membrane were recorded under UV light for total protein display. Total protein was used as loading control to ensure higher comparability and better quantification. Membranes were blocked with 5% skim milk in 1X-TBS-T (Tris Buffered Saline with 20% Tween) and incubated in the recommended dilution of an antibody against HO-1 (Abcam: HO-1 AB52947, 1:1,000) overnight at 4 °C. Membranes were then incubated with the corresponding secondary antibody 1:5000 for chemiluminescence detection and developed on a Fusion FX imaging system with Western Lightning Plus-ECL (Perkin Elmer NEL103001EA). The photometrical analysis provided specific protein levels as well as total protein levels. Additional File 1 provides the raw image data for Western blot analyses.

Gene expression analyses from cells and tissue samples

Cells were harvested by in-well lysis using a Trizol reagent. Tissue samples were immediately homogenized in Trizol and further processed for RNA purification. RNA concentration and purification were done using spin columns (RNEasy mini kit, Qiagen) according to the manufacturer’s protocol. cDNA templates were acquired by reverse transcription (iScript cDNA synthesis kit, BioRad). Gene expression of circadian rhythm genes was then analyzed by real-time PCR (SYBR green master mix, Agilent Technologies) with Rplp0 as a reference gene.

Primer sequences are:

1. Per-2.

Forward: AGGATGTGGCAGGTAACAGG.

Reverse: CGTAAGGGAACACACTGAGAGG.

2. Cry-1.

Forward: TGAGAAATATGGCGTTCCTTCC.

Reverse: GTAAGTGCCTCAGTTTCTCCTC.

3. Rplp0.

Forward: GAGGAATCAGATGAGGATATGGGA.

Reverse: AAGCAGGCTGACTTGGTTGC.

CBA assay

PMG were incubated with blood +/-CO at the indicated concentration and time. Cell supernatant was harvested to be analyzed using bead-based flow cytometry as the manufacturer instructed (BD 552,364, Mouse Inflammation Kit). The following targets were measured on a BD Fortessa flow cytometer: IL-6, IL-10, MCP-1, IFN-γ, TNF and IL-12p70. Data were analyzed with FCAP Array™ Software.

SAH patient data and clinical study design

A total of 66 patients with aneurysmal SAH (19 male, 47 female, age 58.03 ± 13.22 years, range 27–88 years) admitted to either the Intensive Care Units of the Department of Neurology and Neuroscience or the Department of Neurosurgery at the University of Freiburg (Germany) Medical Center between 2017 and 2020 were included in this study. This patient collective represents a subpopulation analysis of a concurrent study with circadian gene expression and chemokine data being a secondary endpoint [27]. An a priori power analysis for the primary endpoint (Wilcoxon-Mann-Whitney-Test, CSF HO-1 expression vs. mRS at discharge favorable/non-favorable, effect size Cohen’s w 0.8; α = 0.05; power 95%, df 2) revealed a necessary sample size of 54 patients for biomarker characterization.

The following criteria for inclusion were applied:

Age > 18 years.

aneurysmal SAH confirmed on CT scan or via lumbar puncture/CSF xanthochromia.

Admission to the ICU and placement of an external ventricular drain (EVD) for therapeutic purposes as well as first CSF and blood sample collection within 24 h after the SAH event.

Provision of informed consent from the patient, legal guardian or by proxy.

The following criteria for exclusion were applied:

Age < 18 years.

Admission later than 24 h after symptom onset.

Current pregnancy.

Death within 24 h of ICU admission.

Evidence of septic aneurysm origin or evidence of ventriculitis/meningitis during the time period of sample collection.

Evidence of subdural/epidural hematoma on initial CT imaging.

CSF and blood samples were obtained from SAH patients on day 1, day 7 and day 14 after SAH symptom onset. Blood samples were obtained from either arterial or central venous catheters, while CSF samples were acquired under sterile conditions from external ventricular drains placed for therapeutic purposes. Blood samples were stored at -80°C in RNA stabilizing reagent tubes (Tempus Blood RNA Tube, AB#4342792). RNA isolation from leukocytes was performed using the correspondent spin-column RNA isolation kit (Tempus Spin RNA Isolation Kit, AB#1710145). RNA content and purity were assessed photometrically (NanoDrop 2000 Spectrophotometer, Thermo Fisher Scientific Inc.). RNA from CSF cells was isolated with Trizol and concentrated by spin-column purification (RNeasy Micro Kit, Qiagen, Hilden, Germany). The reverse transcriptase PCR technique (iScript cDNA Synthesis Kit, BioRad#1708890; PeqStar 96 Universal Gradient, PeqLab) was used to reversely transcribe RNA into cDNA. Semi-quantification of cDNA was performed via real-time PCR (sqPCR; StepOnePlus Real-Time PCR-System, A&V Applied Biosystems) with nucleic acid stain (PowerUp SYBR Green Master Mix, AB#1708020) and specific primers for HO-1 and Rpl13a (ribosomal protein L13a, serving as intra-individual reference gene). CSF and blood samples of patients without intracranial hemorrhage (patients receiving shunt surgery for normal pressure hydrocephalus) served as inter-individual reference population to calculate relative changes in mRNA expression levels. Expression levels of HO-1 mRNA were quantified using the 2−∆∆Ct” (cycle threshold) method, where ∆Ct = Ct (target gene HO-1) – Ct (reference gene Rpl13a) and ∆∆CT = ∆CT (study population) - ∆CT (reference population). Primer Sequences were:

HO-1 forward

GTGATAGAAGAGGCCAAGACTG

HO-1 reverse

GAATCTTGCACTTTGTTGCTGG

PER-2 forward

TCCTCGGCTTGAAACGGC

PER-2 reverse

GAACGAAGCTTTCGGACCTCA

Rpl13a forward

CGGACCGTGCGAGGTAT

Rpl13a reverse

CACCATCCGCTTTTTCTTGTC

The following clinical parameters were collected: SAH severity scores (Hunt & Hess grade, modified Fisher grade, WFNS (World Federation of Neurosurgical Societies) grade), the occurrence of delirium (NuDESC score), modified Rankin Scale (mRS) at admission, discharge and one year after discharge, SAH hematoma volume (semi-quantitative Hijdra sum score on the initial CT scan [32]. Investigators performing clinical and radiographic ratings were blinded regarding laboratory results (gene expression, CBA assay) and vice versa.

For chemokine analysis from patients’ CSF and serum, a bead-based flow cytometry kit was used as the manufacturer instructed (BD 552,990, Human Chemokine Kit). The following targets were measured on a BD Fortessa flow cytometer: IL-8, RANTES, MIG, MCP-1 and IP-10. Data were analyzed with FCAP Array™ Software.

Statistics

Data were analyzed with a computerized statistical program (GraphPad Prism Version 8). Results are presented as means (± SD). Two groups were compared with Student’s t-test and multiple groups were compared with either one-way or two-way ANOVA with post hoc Tukey multiple comparisons. For relative comparison vs. an averaged control group, one-column statistics with the t-test was used. To reduce confounding factors, we calculated relative changes within the data collected on the same day. Mathematically this resulted in the reference population being “1” for in vitro data. Therefore, one-sample t-tests against 1 were used to analyze those data. For better visualization, the reference group is indicated by a line at 1 when the shown data was normalized. Spearman non-parametrical correlation (rs, p), as well as linear regression (r2, P), was used to assess the correlation between metrical data sets (hematoma volume, HO-1/Per-2 expression, MCP-1 concentration, modified Rankin Scale, WFNS grades). Survival curves were analyzed by the Mantel-Cox test. A p-value smaller than 0.05 was considered statistically significant.