Antimicrobial resistance (AMR) poses a significant threat to public health worldwide, and the burden and outcomes of multidrug-resistant (MDR) infections are not yet fully comprehended. Nevertheless, previous research has established a link between infections caused by antibiotic-resistant bacteria and negative patient outcomes such as extended hospital stays, higher mortality rates, and increased morbidity.[1],[2],[3],[4] Several infections related to MDR pathogens require expensive and/or toxic antibiotics (e.g., colistin and daptomycin) that can have adverse impacts on patient outcomes. This issue is compounded in low-income countries such as Iran, where the financial burden of AMR is significant.[4],[5],[6] AMR continues to be a growing issue in hospitals and is associated with the effective spread of MDR clones from hospital-acquired settings into community-acquired infections.[7],[8]

The “ESKAPE” pathogens, considering their economic impact and overall mortality, deserve significant attention at both clinical and research and development levels.[6] In 2008, Rice[9] developed the ESKAPE acronym to describe the organisms that can escape the biocidal action of antibiotics, including E: Enterococcus faecium, S: Staphylococcus aureus, K: Klebsiella pneumoniae, A: Acinetobacter baumannii, P: Pseudomonas aeruginosa, and E: Enterobacter spp. Infections caused by these pathogens are among the most common causes of death, and they can acquire and spread antibiotic resistance.[10] They are responsible for more than half of all health-care-associated infections and have been linked to high rates of AMR.[11] Moreover, the MDR phenotypes of Gram-negative ESKAPE pathogens typically leave clinicians with few treatment options, further complicating the situation.[12] This issue was initially raised by Pseudomonas spp. and Acinetobacter spp. However, Enterobacteriaceae-producing carbapenemase has become a global health threat during the past decade.[13],[14] The carbapenemase enzymes are detected in many other Enterobacteriaceae, including Enterobacter spp.[15] A global priority list of antibiotic-resistant pathogens was developed by the World Health Organization (WHO) to guide antibiotic discovery, and some antibiotic resistance in the Enterobacterales family is listed as a critical priority (such as third-generation cephalosporin-resistant Enterobacterales).[14]

MDR, extensively drug-resistant (XDR), or pandrug-resistant (PDR) clinical isolates have been found several times in ESKAPE isolates. The misuse of antimicrobials and the presence of resistant genes conferring MDR infection are significant issues. In addition, drug-resistant strains of S. aureus, primarily methicillin-resistant S. aureus (MRSA), vancomycin-resistant Enterococcus (VRE), and beta-lactam-resistant bacteria, have been shown to pose a substantial threat to medical establishments.[16]

ESKAPE pathogens that are resistant to antibiotics present the most significant threat to patients who develop bloodstream infections (BSIs) due to a lack of suitable treatment options and effective management. Some challenges that health-care providers encounter include a limited understanding of the invading species, restricted antimicrobial options, and an uncontrolled host reaction to an infection referred to as sepsis. Consequently, patients with BSIs caused by ESKAPE pathogens require immediate and efficacious antibiotic treatment to improve their chances of recovery.[17] Understanding the epidemiology and effectiveness of empirical antibiotic treatment and developing appropriate measures to control the emergence and spread of ESKAPE pathogens is essential to understand the epidemiology of BSIs caused by these pathogens.

There are a limited number of studies that comprehensively evaluate the prevalence and AMR of ESKAPE pathogens in Iran. Therefore, this study aimed to assess the status of these pathogens and their antibiotic resistance profiles, such as the production of β-lactamase enzymes, MRSA, and VRE. In addition, among the nine phenotypic variations of vancomycin resistance in enterococci, strains with vanA and vanB have been found to cause infections in humans.[18] We also investigated the longitudinal trends in the ESKAPE BSI and AMR frequencies at a tertiary university hospital during 1 year of microbiology laboratory activity.

Sample collection

We collected 412 blood samples from patients enrolled in a tertiary university hospital under the supervision of AJA University of Medical Sciences in Tehran, Iran from March 1, 2020, to March 1, 2021.

Those with a recognized bacterial pathogen that is not part of the commensal list, identified by culture of blood specimens, and at least one of the following signs or symptoms: fever over 38°C, chills, or hypotension and not associated with an infection at another site is considered to be true BSIs.[19] Approximately 5–10 mL of peripheral blood was collected from patients by physicians. Blood samples were collected from three different sites for each patient. Following inoculation in blood culture bottles with Trypticase soy broth (Darvash Co., Tehran, Iran), samples were incubated aerobically for 24 h at 35°C–37°C.

We collected demographic data on a questionnaire, such as age, sex, and history of antibiotic consumption. Consumption of antibiotics was considered an exclusion criterion. Each participant filled out a written form of informed consent.

Ethical approval

Ethical consent for this study was given and approved by the AJA University of Medical Sciences ethical committee (IR.AJAUMS.REC.1398.095).

Identification of isolated bacteria

The bacterial identification was done using blood agar, chocolate agar, MacConkey agar, and mannitol salt agar (all from Merck Co., Darmstadt, Germany). For further investigation, only one isolate was considered when the same bacterium was isolated from three samples of the same patient.

In addition to morphological aspects of the colonies that identified growth, standard biochemical tests were performed, including Gram-staining, catalase, oxidase, coagulase, bacitracin, optochin, CAMP, Simmons citrate, urease, indole production, Methyl red/Voges-Proskauer, and oxidase testing.[20]

Antibiotic susceptibility testing

In accordance with the Clinical and Laboratory Standards Institute guidelines, disk diffusion was used to test isolates for antimicrobial susceptibility.[21] We tested isolates with turbidities equal to 0.5 McFarland standards on Mueller-Hinton agar (MHA) plates (Merck Co., Darmstadt, Germany). The antibiotic disks (Mast Diagnostics, UK) were then placed on the MHA plates. The plates were incubated at 35°C–37°C for 24 h. Bacterial isolates were classified into sensitive, intermediate, and resistant groups based on their antibiotic resistance patterns. Based on the definitions of Magiorakos et al. and Tamma et al.,[22],[23] antimicrobial-resistant isolates were categorized as MDR and XDR.

Using standard procedures, VRE, extended-spectrum beta-lactamase (ESBL), carbapenemase, and MRSA isolates were determined.[21] By placing a 2 μg clindamycin and 15 μg erythromycin disks 15 mm apart edge to edge, we detected the presence of induced-macrolide-lincosamide-streptogramin-B (iMLSB) resistance in S. aureus. Inducible clindamycin resistance was confirmed by the evidence of a flattening zone of inhibition around clindamycin disks adjacent to erythromycin disks, known as the “D” zone. E-test methods were also employed to detect vancomycin resistance, metallo-beta-lactamase (MBL), and ESBL production.[21]

We initially screened Gram-negative isolates of ESKAPE pathogens for ESBL using cefotaxime, ceftazidime, and ceftriaxone disks (each 30 μg) (Mast Diagnostics, UK). A potential ESBL-producing isolate was screened if the inhibition zone was ≤27 mm for cefotaxime, ≤22 mm for ceftazidime, and ≤25 mm for ceftriaxone. The E-Test method, combination disk test, and double-disk synergy test (DDST) were performed on these isolates to confirm the production of ESBL.[21],[24]

Detection of metallo-beta-lactamase

The carbapenem disk diffusion method was used to identify carbapenem-resistant isolates.[25]

To detect MBL by phenotypic methods at 25 mm intervals (center to center), two imipenem disks (each 10 g) containing and without anhydrous EDTA (Sigma-Aldrich, Darmstadt, Germany) were placed 25 mm apart. An increase in zone diameter of >4 mm around the imipenem-EDTA disk compared to the imipenem disk alone was considered positive for MBL.[25]

An E-test strip is used in this test, one end of which contains a stable gradient of imipenem, and the other end contains a gradient of imipenem with a constant concentration of EDTA. In this study, MBL producers were inferred to be positive if their MIC ratio between carbapenem alone and imipenem + EDTA MICs was ≥7. The test was done according to the manufacturer's instructions (HiMedia, India).

Detection of vancomycin-resistant Enterococcus phenotypes

E. faecium isolates insusceptible to vancomycin disk (30 μg) were screened as VRE. A vancomycin E-test was then performed according to the manufacturer's instructions (bioMérieux, France). MIC values of ≥32 g/mL of vancomycin were confirmed as VRE isolates.

Molecular detection of vancomycin-resistant Enterococcus

Isolates of VRE with phenotypic confirmation were processed for molecular detection. According to Green and Sambrook,[26] alkaline hydrolysis was used to extract plasmids from VRE isolates. Specific primers for amplification of vanA (F: GGGAAAACGACAATTGC, R: GTACAATGCGGCCGTTA) and vanB (F: ACCTACCCTGTCTTTGTGAA, R: AATGTCTGCTGGAACGATA) were used. All PCR conditions have been previously described.[27],[28]

Statistical analyses

Descriptive statistical analysis (including means with ranges and percentages to characterize data) was performed using SPSS version 22 (Armonk, NY, USA).

Demographics and bacterial isolation

During 2020–2021, 412 patients were enrolled. Fifty-six percent of individuals were female, and 44% were male. The mean age was 48.73 ± 12.46 years (interquartile range: 18–71 years). Overall, 270/412 (65.5%) blood cultures were positive for ESKAPE pathogens. One hundred sixty-eight (62.2%) and 102 (37.8%) Gram-negative and Gram-positive organisms were isolated from blood cultures, respectively. S. aureus was the most frequently isolated bacteria (81/270, 30%), followed by A. baumannii (59/270, 22%) and P. aeruginosa (46/270, 17%). The frequency of ESKAPE pathogens isolated from blood cultures is shown in [Figure 1].

Click here to view

Antibiotic susceptibility testing

The AMR pattern of Gram-positive isolates of ESKAPE pathogens is shown in [Table 1]. In brief, all the E. faecium isolates were resistant to ciprofloxacin and ampicillin (100%). More than half of E. faecium isolates were resistant to tetracycline (76.1%), followed by tigecycline (71%). However, only one isolate was resistant to linezolid (4.7%). A large number of S. aureus isolates were resistant to erythromycin (69.1%) and ciprofloxacin (66.6%). Sixty-four percent of S. aureus isolates were resistant to trimethoprim/sulfamethoxazole. More than 70% of the isolates were MRSA and 79% were MDR. None of the S. aureus isolates were resistant to vancomycin, teicoplanin, tigecycline, and linezolid [Table 1].

Click here to view

Thirty-one percent of K. pneumoniae isolates were resistant to cefixime. It should be noted that 43% of the isolates showed resistance to imipenem [Table 2]. A. baumannii showed 96.6% resistance to ciprofloxacin, 94.9% to imipenem, and 77.9% to ceftazidime. Furthermore, they were most resistant to piperacillin–tazobactam (89.8%) [Table 2]. Most P. aeruginosa isolates were resistant to chloramphenicol (95%), followed by 61% to piperacillin–tazobactam and 45.6% to trimethoprim/sulfamethoxazole. On the other hand, nearly a quarter of the isolates were resistant to cefepime (24%). The most effective antibiotics against E. aerogenes were imipenem, with a 96.5% susceptibility rate, followed by amikacin and trimethoprim/sulfamethoxazole, with 75% each. In contrast, the less effective antibiotics were cefixime, with an 89% resistance rate. The detailed results of the antibiotic resistance test for Gram-positive ESKAPE pathogens are presented in [Table 2].

Click here to view

Among the Gram-positive ESKAPE pathogens, more than 77% (79/102) were MDR, and almost 6% (6/102) were XDR [Table 3]. Nearly 37% (62/168) of the Gram-negative isolates were found to be MDR and 21% (36/168) XDR. The major drug-resistant pathogens among Gram-negative members of ESKAPE were E. aerogenes (60.7% MDR and 10.7% XDR), followed by A. baumannii (MDR and XDR 38.9% each) and P. aeruginosa (34.7% MDR and 17.3% XDR) [Table 3].

Click here to view

Detection of vanA and vanB Genes among vancomycin-resistant Enterococcus isolates

A PCR analysis using vancomycin-specific primers was used to screen for vanA and vanB genes in genomic DNA/plasmid. The vanA gene was present in all 4 (19%) VRE isolates.

Extended-spectrum beta-lactamase and metallo-beta-lactamase-producing Gram-negative ESKAPE Pathogens

A total of 61 Gram-negative ESKAPE pathogens were found to be resistant to third-generation cephalosporins. Out of these, 41 were confirmed to be ESBL positive through the DDST combination disk and E-test methods. In addition, 88 isolates were found to be resistant to carbapenem (imipenem), out of which 35 were phenotypically confirmed to be MBL-positive through the combining disk and E-test methods. Based on the results shown in [Table 3], A. baumannii was the primary producer of ESBLs (39%), followed by P. aeruginosa (35.7% ESBL, 28.2% MBL) and K. pneumoniae (25.7% ESBL, 17.1% MBL).

AMR has caused many challenges in ensuring the health of individuals and communities. In addition, it has caused limitations in treatment due to the lack of new antibiotics.[29] AMR has caused many challenges in ensuring the health of individuals and communities. Moreover, the lack of new antibiotics limits treatment choices, while the inappropriate and excessive use of antibiotics can cause resistance, which further limits choices by increasing inaccurate antibiotic prescriptions.[30]

ESKAPE pathogens are microorganisms that have caused numerous issues in global health, resulting in higher mortality rates. This is mainly due to their resistance to multiple drugs.[30] ESKAPE pathogens have been widely studied due to their ability to resist particular antibiotics either innately or through the acquisition of different resistances.[6] Higher hospital and antibiotic treatment costs set a more significant financial burden on the patient and society.[30]

Finding demonstrates that the frequency of health-care-associated infections in countries with limited financial resources is higher than in countries with high incomes.[31] Moreover, research has shown that AMR and its consequences affect patients in low-income areas more than those in high-income areas.[6] Therefore, understanding the frequency and antibiotic resistance of ESKAPE pathogens can lead to informed decisions to combat them and prevent their proliferation through research.

In the present study, 65.5% of blood cultures were positive for ESKAPE pathogens. In other studies, 24%,[32] 34%,[33] 42.2%,[34] and 44%[35] of blood cultures were positive for ESKAPE pathogens. These differences can be caused by the conditions of the individuals included in the studies. In some studies, only people with cancer were investigated;[32],[33] in another study, solid organ transplantation individuals were evaluated.[35] However, in the present study, there was no specific group of patients.

The results showed that S. aureus (30%), A. baumannii (22%), and P. aeruginosa (17%) were the most frequent among ESKAPE pathogens, respectively. Similar to our finding, S. aureus has been reported as the most prevalent pathogen, but K. pneumoniae and Klebsiella spp. were the second prevalent ESKAPE pathogen isolated from blood cultures.[34],[36],[37] Conversely, some studies have reported K. pneumoniae and S. aureus as the most prevalent pathogens in this category, respectively.[32],[38] Consistent with our results, some studies have reported P. aeruginosa as the third prevalent pathogen isolated from ESKAPE.[34],[37],[38] Thus, it can be declared that one of the most frequent pathogens of this group that causes bacteremia is S. aureus.

Compared to E. faecalis, E. faecium BSIs have more excellent rates of drug resistance and death. Due to vancomycin-resistant species, BSIs are among the worst hospitalized illnesses that can be fatal.[39] Vancomycin resistance in E. faecium is rapidly increasing and has caused many concerns in treating health-care-associated infections.[9] This study showed that 19% of E. faecium was resistant to vancomycin. There has been information on vancomycin resistance E. faecium ranging from 0.1% in the Netherlands to 67% in Brazil. The Eastern Mediterranean area had the most significant incidence of vancomycin resistance.[39] The differences in managing stewardship programs are one of the most critical elements causing these discrepancies.[39] Our results showed that the vanA gene was present in all VRE isolates, which was entirely consistent with the studies performed in Nepal and Mexico.[40],[41]

Seventy-nine percent of the S. aureus in the current study was MDR, and 70% of it was MRSA. All of the isolates were sensitive to linezolid and vancomycin. In Italy, the prevalence of MRSA and MDR was 39.5% and 40.3%, respectively. Consistent with our results, all S. aureus were sensitive to linezolid and vancomycin.[37] In the study conducted in Hungary, 19% of the strains were MRSA, and 20% were MDR; vancomycin and linezolid were effective antibiotics for all isolates.[36]S. aureus is a primary cause of BSIs and is associated with high mortality rates. The increasing incidence of MRSA infections is a cause of concern, as it seems to be altering the epidemiology of S. aureus BSIs.[37]

Bacterial pathogens are divided into three critical, high, and moderate categories in the 2017 WHO global priority pathogen list. The critical priority category includes A. baumannii, P. aeruginosa, and K. pneumoniae, which are carbapenem resistant.[42] In the current study, the rate of resistance to imipenem and MBL producers in A. baumannii, K. pneumoniae, P. aeruginosa, and E. aerogenes (Klebsiella aerogenes) were 94.9% and 39%, 42.8% and 17.1%, 34.7% and 28.2%, and 3.5% and 0%, respectively. With 60.7% MDR and 10.7% XDR, E. aerogenes dominated the drug-resistant pathogens among the Gram-negative members of ESKAPE isolates. It was followed by A. baumannii (MDR and XDR 38.9% each), P. aeruginosa (34.7% MDR and 17.3% XDR), and K. pneumoniae (17.1% MDR and 5.7% XDR).

Consistent with our results, a recent study conducted on ESKAPE pathogen reported the highest resistance to meropenem and MBL producer in A. baumannii (51.3% and 10.3%), K. pneumoniae (17.4% and 8.1%), and then P. aeruginosa (15.5% and 8.3%). However, their rate is lower than our results. Furthermore, the MDR and XDR rate for each mentioned bacteria was 30.7% for both, 32.2% and 12.8%, 14.3%, and 7.1%, respectively.[41] Resistance to carbapenem and MDR has been documented in Spain for Acinetobacter spp. at 63.2% and 51.1%, P. aeruginosa at 20.7% and 10.9%, and K. pneumoniae at 3.6% and 13%, respectively.[43] In Enterobacterales, there is a variety of issues that are fostering the establishment, persistence, and quick spread of carbapenem resistance. The key factors influencing this pattern are the spread of MDR clones and the occurrence of coresistance to more antibiotics like colistin.[43] A rise of MBLs on the plasmid has been a cause for concern because MBLs such as imipenem and the New Delhi MBL-1 result in carbapenem resistance. The same factors can also cause resistance to other drugs.[9]

In this study, 25.7% of K. pneumoniae were ESBL producers. According to recent research, 31% of K. pneumoniae cases produced ESBLs, which is comparable to our findings (6). Furthermore, other studies have reported 18.4% in Italy and 23.1% in Spain.[37],[43] Due to the increased usage of carbapenems to treat infections brought on by K. pneumoniae ESBL producers, resistance to these drugs has also developed.[44] There is a concern regarding the rise in resistance, and it is vital to take more substantial precautions to control these infections because no effective drugs for treatment have low toxicity.[9]

There are several limitations to this study. First, the study examined a small number of patients who were admitted to a university hospital in Tehran. As a result, the number of samples and isolates was relatively low, and further testing is needed to confirm the findings. Second, this study is a single-center analysis of laboratory data without any connection to clinical outcomes or patient characteristics. Third,  Escherichia More Details coli, which is a challenging organism in bacteremia, was not detected in our study. To better understand the status of ESKAPE pathogens in Tehran health centers and hospitals, future studies should collect samples and demographic information from a larger number of hospitals in the area. Despite these limitations, the significant findings on antimicrobial susceptibility patterns remain noteworthy.

Our study highlights the increasing prevalence of ESKAPE pathogens among patients with BSIs. While vancomycin and linezolid still have a good effect, the development of vancomycin resistance in E. faecium and the rising MRSA cases are causes for concern. Moreover, the meropenem resistance in A. baumannii is relatively high and poses a threat to its effectiveness. Other ESKAPE Gram-negative pathogens are also becoming more resistant to meropenem. Overall, significant levels of antimicrobial drug resistance are observed among most ESKAPE pathogens. Therefore, it is crucial for stewards to consider the increasing resistance and incorporate new measures, such as AMR surveillance targeting ESKAPE pathogens, into the infection control policy in Iran.

Financial support and sponsorship

None.

Conflicts of interest

There are no conflicts of interest.