RESEARCH ARTICLE Year : 2023  |  Volume : 60  |  Issue : 1  |  Page : 65-73

The relationship between MMP-2 rs243865, MMP-9 rs398242 and CXCL-12 rs1801157 gene polymorphisms with Japanese encephalitis disease and disease outcome in North Indian population

Rashmi Tiwari1, Sneha Ghildiyal2, Pooja Gaur2, Tanzeem Fatima2, Shivbrat Upadhyay3, Janmejai K Srivastva4, Virendra Atam5, Tapan N Dhole2
1 Sanjay Gandhi Post Graduate Institute of Medical Sciences; Amity Institute of Biotechnology, Amity University Uttar Pradesh, Lucknow, India
2 Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, Uttar Pradesh, India
3 Era ’s Lucknow Medical College and Hospital, Lucknow, Uttar Pradesh, India
4 Amity Institute of Biotechnology, Amity University Uttar Pradesh, Lucknow, India
5 King George Medical University, Lucknow, Uttar Pradesh, India

Date of Submission04-May-2022Date of Acceptance11-Oct-2022Date of Web Publication5-Apr-2023

Correspondence Address:
Janmejai K Srivastva
Director and Head, Amity Institute of Biotechnology, Amity University, Lucknow, Uttar Pradesh, India.
India

Source of Support: None, Conflict of Interest: None

Check

DOI: 10.4103/0972-9062.361176

Background & objectives: Japanese encephalitis virus (JEV) is one of the most important causes of acute and uncontrolled inflammatory disease in Asia. Matrix metalloproteinases (MMPs) and chemokines play a detrimental role in the host response to JE disease, aetiology, and disease outcome. Evidently, MMPs are widely circulated in the brain and regulate various process including microglial activation, inflammation, blood-brain barrier disruption as well as affects central nervous system (CNS). The present study was to assess the association of single nucleotide polymorphisms of MMP-2, MMP-9 and chemokine (CXCL-12/SDF1-3’) in the north Indian population.
Methods: We performed case-control study comprising of 125 patients and 125 healthy controls in north Indian population. Genomic DNA was extracted from whole blood and gene polymorphism have been determined by PCR-RFLP method.
Results: MMP-2, MMP-9 and CXCL-12 gene was not significantly associated with JE disease, but homozygous (T/T) genotype of MMP-2 was statically associated with disease outcome (p=0.05, OR=0.110). A/G and G/G genotype of CXCL-12 was significantly associated with severity of disease. (p=0.032, OR=5.500, p=0.037, OR= 9.167).
The serum level of MMP-2 was observed significantly increased in JE patients with homozygous (T/T) genotype whereas increased MMP-9 level was associated with heterozygous genotype.
Interpretation & conclusion: MMP-2, MMP-9 and CXCL-12 gene polymorphism were not associated with JE susceptibility, but MMP-2 may be contributed to disease protection. CXCL-12 was associated with disease severity.
In our concern this is the first report from northern India.

Keywords: Japanese Encephalitis; MMP-2; MMP-9; CXCL-12; Gene polymorphism

How to cite this article:
Tiwari R, Ghildiyal S, Gaur P, Fatima T, Upadhyay S, Srivastva JK, Atam V, Dhole TN. The relationship between MMP-2 rs243865, MMP-9 rs398242 and CXCL-12 rs1801157 gene polymorphisms with Japanese encephalitis disease and disease outcome in North Indian population. J Vector Borne Dis 2023;60:65-73
How to cite this URL:
Tiwari R, Ghildiyal S, Gaur P, Fatima T, Upadhyay S, Srivastva JK, Atam V, Dhole TN. The relationship between MMP-2 rs243865, MMP-9 rs398242 and CXCL-12 rs1801157 gene polymorphisms with Japanese encephalitis disease and disease outcome in North Indian population. J Vector Borne Dis [serial online] 2023 [cited 2023 Apr 6];60:65-73. Available from: http://www.jvbd.org//text.asp?2023/60/1/65/361176   Introduction 

Japanese encephalitis (JE) is one of the most acute and uncontrolled nervous system disease. Globally 67,900 people are infected with encephalitis virus every year and 10,000–15,000 deaths occur approximately. Almost 20%–30% of fatality rate is seen in JE cases whereas 30%–50% of survivors have neurologic or psychiatric sequelae[1],[2],[3].

Japanese encephalitis virus is a single stranded RNA virus approximately 11kb in size, belonging to family Flaviviridae, and transmitted by Culex species (Culex tritaeniorhynchus summorosus). It is widely known that this is an infectious disease which destroy the central nervous system (CNS) manifesting with fever, headache, vomiting, signs of meningeal irritation and neurological sequel. After infection in the brain JEV induces microglial activation. Microglias are the resident immune cells of the central nervous system and release the neuroprotective factors to assist the recovery of injured neurons. Activated microglia leads to the several immune-related proteins such as complement factors, cytokines chemokines (MCP-1, MIP-1a, MIP-1b, RANTES) and matrix metalloproteinases (MMPs). Cytokine, chemokine and MMPs storm contributes to severe complications following infection[4],[5],[6],[7],[8],[9].

Matrix metalloproteinases (MMPs) are defined to calcium-dependent zinc endopeptidases that have the potential to reduce all types of extracellular matrix (ECM) and play a key role in the pathogenesis of JEV infection, inflammation, neurogenesis, and matrix degradation. The chemokine, CXCL-12 (SDF1) is secreted by marrow stromal and endothelial cells, heart skeletal muscle, liver, brain, and kidney parenchyma. It is found to be a potential therapeutic target for a wide variety of inflammatory diseases. Previous study has shown that host innate, and adaptive immune responses are involved in increasing or controlling viral load in JEV infected patients[2],[9],[10],[11],[2],[13]. Various study reported polymorphism of MMP-2, MMP-9 and CXCL-12/SDF1-3’ in several infectious and inflammatory disease and disease pathogenesis[1],[13],[14][15]; thus, the present study was designed to examine the genetic relationship between MMP2 -1306C>T, MMP-9 -1562C>T and CXCL-12 gene polymorphism with Japanese encephalitis disease in north Indian population.

  MATERIAL & METHODS 

Study population

A total number of 793 patients with acute encephalitis syndrome who were admitted to Department of Medicine and Department of Paediatric, King George Medical College, Lucknow, India were examined for JE virus specific IgM antibodies. Out of them 125 were positive for JEV. Patient’s details were recorded with symptoms like fever, headache, vomiting, abnormal behaviour, altered mental status, seizures, and baseline Glasgow coma scale (GCS) score, during enrolment with the help of a questionnaire. Patients were followed up to 6 months after discharge and their outcome was recorded.

Sera separation and DNA Extraction

2 ml blood samples were collected in ethylene diamine tetra-acetic acid vial as well as plain vial. Blood was centrifuged at 3000 rpm for 5 min then serum was separated. DNA was extracted by using Qiagen DNA extraction kit and stored at -20°C. DNA purity and concentration were analysed by NanoDrop 2000 spectrophotometer (Thermo fisher).

SNP sequencing

The amplification primers used for MMP-2 -1306C/T was F5’-CTTCCTAGGCTGGTCCTTAC3’,R5’AGACCTGAAGAGCTAAAGACT3’,MMP- 9-1562C/T, F5’GCCTGGCACATAGTAGGCCC3’, R5’CTTCCTAGCCAGCCGGCATC3’and CXCL-12/SDF1-3’F-5’-CAGTCAACCT GGGCAAAGCC3’,R-5’-CCTGAGAGTCCTTTTGCGGG-3’. The PCR reaction for MMP-2 and MMP-9 included 2 μl of DNA template, 0.3 μl each of upstream and downstream primers, 18 μl of PCR Master Mix with nuclease free water. The total reaction volume was 20 μl The PCR conditions used were as follows: 94°C for 2 min, 94°C for 1 min, 52°C for 1 min, 72°C for 1 min, cycled for 35 times, extension at 72°C for 5 min and CXCL-12/SDF1-3’ PCR reaction were as follows: 94°C for 5 min, 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, cycled for 35 times, extension at 72°C for 10 min and stored at 4°C. The specific restriction endonucleases Pae I (Sph I) (CutSmart, New England Biolabs), BfaI (CutSmart, New England Biolabs) and HpaII (CutSmart, New England Biolabs) were used to cut the PCR products of MMP-2 -1306C>T, MMP-9 -1562C>T and CXCL-12/SDF1-3’ respectively. Gel electrophoresis was used to detect the PCR products[15],[16].

Genotype analysis of the MMP-2 -1306C>T and MMP-9 -1562C>T polymorphisms

The PCR amplified DNA strand of MMP-2 -1306C>T has 188 bp. After using Sph I restriction enzyme, we found the wild genotype CC (188 bp), the heterozygous genotype CT (188 bp, 162 bp, 26 bp and 5 bp) and the homozygous genotype TT (162 bp, 26 bp, and 5 bp). The 26 bp and 5 bp fragments were not shown in gel image since they were too small in size. The MMP-9-1562C>T gene has 435 bp. After using BfaI restriction enzyme, the wild-type genotype CC (435 bp), the heterozygous genotype CT (435 bp, 247 bp, 26 bp and 188 bp) and the homozygous genotype TT (247 bp and 188 bp) were observed. The CXCL-12/SDF1-3’A gene has 293 bp. After using HpaII restriction enzyme, wild genotype AA (293bp), the heterozygous genotype AG (293bp,193bp,100bp) and the homozygous genotype GG (193bp, 100bp) were observed [Figure 1].

Figure 1: Agarose gel electrophoresis illustrating A. MMP-2 1306C>T, B. MMP-9 1562C>T, and C. CXCL-12/SDF1-3’ A gene polymorphism.

Click here to view

Statistical analysis

The data was determined using the SPSS statistical software (version 20.0, Chicago, LA) and GraphPad Prizm 5. The genotype by chi square test (with the level of significance at <0.05) between different group. Allele’s outcome was calculated using an odds ratio (OR) and a 95% confidence interval (CI). Quantified data were expressed as mean ± Standard deviation whereas; categorical variables were presented as a percentage or ratio. Logistic regression study was applied to estimate predictors of the JEV susceptibility and considered significant if the p values were ≤0.05. The protein levels of MMP-2 MMP-9 and CXCL-12 were compared using the two tailed test.

Ethical statement

This study was reviewed and approved by research cell committee from King George Medical University (KGMU) (92nd ECM IIA/P2), Lucknow, India and written informed consent was given by all subjects.

  Results 

A total number of 793 patients (children and adults) with acute encephalitis syndrome were screened for JE, among them, 125 were found JE positive cases (83 male and 42 females, mean age 23.25 ± 16.02 years) and 125 controls of same age and sex matched were included. Demographic and clinical characteristics of patients are detailed in [Table 1].

Association MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’A gene polymorphism with clinical symptoms in JE patients.

We determined the gene polymorphism of MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’A with clinical symptoms of JE disease and we found that gene polymorphism was statistically associated with all clinical symptoms (p<0.05) [Table 2].

Table 2: Genotype frequencies of A. MMP-2 1306C>T and MMP-9 1562C>T and, B. CXCL-12/SDF1-3’A in clinical symptoms of JE patients

Click here to view

Association of MMP-2 1306C>T and MMP-9-1562C>T polymorphism in JE patients

We examine the association of MMP-2 and MMP-9 gene polymorphism with JE disease as compared to healthy controls. We found that homozygous (T/T), and heterozygous (C/T) genotype of MMP-2 and MMP-9 was not associated with risk of JE disease (p=0.44, OR = 1.56, 95% CI =0.495-4.49) and (p=0.30, OR=0.47, 95% CI=.117-1.959) respectively [Table 3].

Table 3: Genotype and allele frequencies of MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’ (A/G) genes in JE patients and healthy controls

Click here to view

Association of CXCL-12/SDF1-3’ (A/G) gene polymorphism in JE disease

We determined the association of CXCL-12/SDF1-3’ (A/G) gene polymorphism between patients and healthy control. We observed that the homozygous(G/G) and heterozygous (A/G) genotypes were not associated in JE disease as compared to wild (A/A) genotype (p=0.54, OR = 1.51, 95% CI = (0.399-5.679) and p=0.430, OR=0.785, 95% CI=0.431-1.431) [Table 3].

Association of MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’ (A/G) polymorphism with severity in JE patients

We examined MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’ gene polymorphism with disease severity and observed that homozygous and heterozygous genotype of CXCL-12/SDF1-3’ (A/G) was statically associated with disease severity in JE patients (p=0.037, OR = 9.167, 95% CI = (1.147-73.239) and p=0.032, OR=5.500, 95% CI = (1.162-26.040) but MMP-2-1306C>T and MMP-9-1562C>T gene was not associated with disease severity [Table 4]. Severity and moderate was selected by GCS score.

Table 4: Genotype and allele frequencies of MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’ (A/G) genes in clinical severity of JE patients and correlation with outcome

Click here to view

Association of MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’(A/G) polymorphism with outcomes in JE patients

The outcome was observed after 6 months in 98 JE patients out of 125. Among 98 patients, 53 were recovered with neurological sequelae whereas, 37 were completely recovered and a total of 8 (8.16) patients died in hospitals. Neurological sequelae are medical illness associated with central nervous system resulting from a previous infection. To check the genotypic and allelic frequency distribution of MMP-2 1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’ (A/G) with disease outcomes. We analysed the data between recovered with neurological sequel and completely recovered patients. Homozygous genotype (T/T) of MMP-2-1306C>T were significantly associated with those patients who completely recovered as compared to recovered with neurological sequelae (p=0.05, OR=0.110, 95% CI= (0.012-1.002) [Table 4]. Heterozygous and homozygous genotype MMP-9-1562C>T and CXCL-12/SDF1-3’ (A/G) were not associated with disease outcome [Table 4].

Concentration of MMP-2 in different genotype

The serum concentration of MMP-2 was significantly higher in JE patients as compared to healthy individuals [Figure 2]A. Homozygous (T/T) genotype had significantly higher level of MMP-2 in serum samples as compared to wild C/C genotype (p=0.0223) [Figure 2]B.

Figure 2: Serum level of MMP-2 in JE patients versus healthy controls A. and in different genotypes of MMP-2 in JE patients B. in JE patients homozygous genotypes of MMP-2 (T/T) proved a significantly increases in MMP-2 serum levels as compared to patients having wild genotypes (C/C). JE patients demonstrated a significant increase in MMP-2 serum concentration as compared to healthy controls.

Click here to view

Concentration of MMP-9 in different genotype

The serum concentration of MMP-9 was significantly higher in JE infected patients as compared to healthy controls (p=0.0490) [Figure 3]A. Severe patients had a significantly higher concentration of MMP-9 in individuals having heterozygous genotype (C/T) when compared to wild (C/C) genotype (p=0.0233) [Figure 3]B.

Figure 3: Serum level of MMP-9 in JE patients versus healthy controls A. and in different genotypes of MMP-9 in JE patients B. in JE patients heterozygous genotypes of MMP-9 (C/T) demonstrated a significant increase in MMP-9 serum levels as compared to patients having wild genotypes (C/C). JE patients demonstrated a significant increase in MMP-9 serum level as compared to healthy controls

Click here to view

  Discussion 

Japanese encephalitis is a neuroimmunological disease, which causes high mortality in various pediatric groups. Generally, the JEV infection ranges from an asymptomatic infection to meningoencephalomyelitis with cortical blindness and spinal cord injury. After JEV infection in brain, the virus resides and reproduces within host leukocytes which play an important role in JEV pathogenesis and destroys the central nervous system (CNS) cells. JEV induces human peripheral blood monocytes to secrete inflammatory mediators. Immune- related proteins are essential to produce a potent immune response and contributing to host defense in a various disease[1],[2],[9],[17],[18],[19],[20]. MMPs are natural inhibitors that play a key role in the pathogenesis of neurotropic viral disease and leading to blood brain barrier damage, neuroinflammatory processes and meningeal oed. MMPs has been introduced as a marker of meningitis, neurotropic viruses and neuroinflammation[8],[9],[15],[21].

Chemokine (CXCL-12) or stromal cell-derived factor 1 (SDF-1) is a small chemotactic cytokine that binds to the G-protein-coupled seven-transmembrane span CXCR4. It is associated in cell trafficking, migration, inflammation, and proliferation and their mobilization from the bone marrow to the peripheral circulation[22],[23],[24],[25]. CXCL-12 also play an important role in neuroinflammation by attacking leucocytes across the blood brain barrier.

In the current study, we investigated the relationship between MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’ (A/G) gene polymorphisms with clinical symptoms in JE infected patients of north Indian population. Our finding that MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1-3’ (A/G) were associated with all clinical symptoms like (fever, headache, vomiting, altered mental status, behavioral abnormalities and neck stiffness). We observed that homozygous and heterozygous genotype of MMP-2-1306C>T was not associated with risk of disease (p=0.44, OR=1.567, CI= (0.495-4.492). After that we analyzed the data between severe and moderate patients and also between recovered patients with neurological sequel and completely recovered. T/T genotype had been associated with completely recovered as compared to recovered with neurological sequelae but not associated with clinical severity. Previous studies proved that MMPs play key roles in the pathogenesis of CNS illnesses. Protein concentration of MMP-2 was significantly higher in serum and with Homozygous (T/T) genotype as compared to wild (C/C) genotype in JE patients.

The results showed that the allelic frequency of MMP-9 - 1562C>T genotypes was not significantly associated with case and control groups. We determined the data between recovered with neurological sequelae and completely recovered, we have no association with clinical severity as well as disease outcome. Our study specified that in severe patients of the disease, protein concentration of MMP-9 was higher in heterozygous (C/T) genotype as compared to wild (C/C) genotype and significantly increased the level of protein in serum of JE patients as compared healthy controls.

CXCL-12/SDF1-3’ (A/G) gene polymorphism was not associated with JE susceptibility and disease outcome whereas we investigated between severe and moderate patients, showed homozygous and heterozygous genotype significantly associated with clinical severity (p=0.032, OR=5.500 95% CI=1.162-26.040) (p=0.037, OR=9.167 95% CI=1.147-73.239) [Table 4].

  Conclusion 

This case control study indicates that MMP-2-1306C>T, MMP-9-1562C>T and CXCL-12/SDF1’ gene polymorphism has a significant role in the progression of clinical symptoms in JE disease but not associated in disease susceptibility. Homozygous (T/T) genotype of MMP-2 was statically associated with disease outcome. CXCL-12 gene polymorphism was not associated with disease outcomes but homozygous (G/G) genotype of CXCL-12 was associated with disease severity. Further studies will be needed to explain the genetic effects of such polymorphisms in other racial groups.

Conflict of interest: None

  Acknowledgements 

The author acknowledge Mr. Hemant Varma and Dr. Manjari Baluni for providing technical as well as writing assistance during the work.

 

  References 
1.Baluni M, Fatima T, Zia A, Reddy DH, Dhole TN. Association of ICAM-1 (K469E) and MCP-1-2518 A> G polymorphism with risk of Japanese encephalitis in North Indian population. Cytokine 2018; 111: 420–7.  
    2.Chowdhury P, Khan SA. Significance of CCL2, CCL5 and CCR2 polymorphisms for adverse prognosis of Japanese encephalitis from an endemic population of India. Scientific reports 2017; 7(1): 1–9.  
    3.Wang H, Liang G. Epidemiology of Japanese encephalitis: past, present, and future prospects. Therapeutics and clinical risk management 2015; 11: 435.  
    4.Quagliarello VJ, Wispelwey B, Long WJ, Scheld WM. Recombinant human interleukin-1 induces meningitis and blood-brain barrier injury in the rat. Characterization and comparison with tumor necrosis factor. The Journal of clinical investigation 1991; 87(4): 1360–6.  
    5.Barkhash AV, Yurchenko AA, Yudin NS, Ignatieva EV, Kozlova IV, Borishchuk IA, et al. A matrix metalloproteinase 9 (MMP9) gene single nucleotide polymorphism is associated with predisposition to tick-borne encephalitis virus-induced severe central nervous system disease. Ticks and tick-borne diseases 2018; 9(4): 763–7.  
    6.Kumar R, Mathur A, Kumar A, Sharma S, Chakraborty S, Chaturvedi UC. Clinical features & prognostic indicators of Japanese encephalitis in children in Lucknow (India). The Indian journal of medical research 1990; 91: 321–7.  
    7.Wang K, Deubel V. Mice with different susceptibility to Japanese encephalitis virus infection show selective neutralizing antibody response and myeloid cell infectivity. PloS one 2011; 6(9): e24744.  
    8.Ghoshal A, Das S, Ghosh S, Mishra MK, Sharma V, Koli P, et al. Proinflammatory mediators released by activated microglia induces neuronal death in Japanese encephalitis. Glia 2007; 55(5): 483–96.  
    9.Shukla V, Shakya AK, Dhole TN, Misra UK. Matrix metalloproteinases and their tissue inhibitors in serum and cerebrospinal fluid of children with Japanese encephalitis virus infection. Archives of virology 2013; 158(11): 2561–75.  
    10.Abraham S, Shwetank GK, Manjunath R. Japanese encephalitis virus: innate and adaptive immunity. Flavivirus encephalitis 2011; 339(10.5772): 22083.  
    11.Demacq C, Vasconcellos VB, Marcaccini AM, Gerlach RF, Machado AA, Tanus-Santos JE. A genetic polymorphism of matrix metalloproteinase 9 (MMP-9) affects the changes in circulating MMP-9 levels induced by highly active antiretroviral therapy in HIV patients. The Pharmacogenomics Journal 2009; 9(4): 265–73.  
    12.Solomon T, Dung NM, Kneen R, Gainsborough M, Vaughn DW, Khanh VT. Japanese encephalitis. Journal of Neurology, Neurosurgery & Psychiatry 2000; 68(4): 405–15.  
    13.De Oliveira KBo, Guembarovski RL, Oda JMM, Mantovani MrSr, Carrera CM, Reiche EMV, et al. CXCL-12 rs1801157 polymorphism and expression in peripheral blood from breast cancer patients. Cytokine 2011; 55(2): 260–5.  
    14.Mishra P, Prasad KN, Singh K, Sahu RN, Ojha BK. Association of ICAM-1 (K469E) and MCP-1â’ 2518 A> G gene polymorphism with brain abscess. Journal of neuroimmunology 2016; 292: 102–7.  
    15.Zhen G-D, Zhao L-B, Wu S-S, Chen M-Y, Li Z-H, Zhou S-Z, et al. Associations of MMP-2 and MMP-9 gene polymorphism with ulinastatin efficacy in patients with severe acute pancreatitis. Bioscience Reports 2017; 37(4).  
    16.Lee Y-L, Kuo W-H, Lin C-W, Chen W, Cheng W-E, Chen S-C, et al. Association of genetic polymorphisms of CXCL-12/SDF1 gene and its receptor, CXCR4, to the susceptibility and prognosis of non-small cell lung cancer. Lung Cancer 2011; 73(2): 147–52.  
    17.Gehrmann J, Matsumoto Y, Kreutzberg GW. Microglia: intrinsic immuneffector cell of the brain. Brain research reviews 1995; 20(3): 269–87.  
    18.Pujhari SK, Ratho RK, Prabhakar S, Mishra B, Modi M. TNF-α promoter polymorphism: a factor contributing to the different immunological and clinical phenotypes in Japanese encephalitis. BMC infectious diseases 2012; 12(1): 1–6.  
    19.Singh A, Kulshreshtha R, Mathur A. An enzyme immunoassay for detection of Japanese encephalitis virus-induced chemotactic cytokine. Journal of biosciences 2000; 25(1): 47–54.  
    20.Tiwari R, Ghildiyal S, Baluni M, Singh D, Srivastva JK, Kumar R, et al. Association of interleukin-6 (174 G/C) and interleukin-12B (1188 A/C) gene polymorphism with expression and risk of Japanese encephalitis disease in North Indian population. Journal of neuroimmunology 2021; 358: 577630.  
    21.Tsai HC, Shi MH, Lee SJ, Wann SR, Tai MH, Chen YS. Expression of matrix metalloproteinases and their tissue inhibitors in the serum and cerebrospinal fluid of patients with meningitis. Clinical microbiology and infection 2011; 17(5): 780–4.  
    22.Fulton AM. The chemokine receptors CXCR4 and CXCR3 in cancer. Current oncology reports 2009; 11(2): 125–31.  
    23.Darash-Yahana M, Pikarsky E, Abramovitch R, Zeira E, Pal B, Karplus R, et al. Role of high expression levels of CXCR4 in tumor growth, vascularization, and metastasis. The FASEB Journal 2004; 18(11): 1240–2.  
    24.Müller A, Homey B, Soto H, Ge N, Catron D, Buchanan ME, et al. Involvement of chemokine receptors in breast cancer metastasis. Nature 2001; 410(6824): 50–6.  
    25.Butrym A, Gebura K, Iwaszko M, Kuliczkowski K, Boguniaâ Kubik K, et al. Dual role of the CXCL-12 polymorphism in patients with chronic lymphocytic leukemia. Hla 2016; 87(6): 432–8.  
    
  [Figure 1], [Figure 2], [Figure 3]
 
 
  [Table 1], [Table 2], [Table 3], [Table 4]