記住我
SHORT RESEARCH COMMUNICATION
Year : 2023 | Volume
: 60
| Issue : 1 | Page : 106-110
Investigation of Chikungunya virus genotype at tertiary care center in Western Maharashtra, India
Kalpana Tikaram Suryavanshi, Ankana Chakraborty
Department of Microbiology, Bharati Vidyapeeth Deemed To Be University & Medical College, Pune, India
Correspondence Address:
Kalpana Tikaram Suryavanshi
Department of Microbiology, Bharati Vidyapeeth Deemed To Be University & Medical College, Pune
India
Source of Support: None, Conflict of Interest: None
CheckDOI: 10.4103/0972-9062.353231
Background & objectives: Chikungunya is a reemerging arbovirus infection. Laboratory diagnosis can be done by Classical test involving Rapid Immunochromatography, Enzyme-Linked Immunosorbent assay and Molecular methods. The present study was undertaken to know the genotype of the Chikungunya virus (CHICKV) among patients suspected of CHICKV and investigated by virus culture, partial sequencing, Rapid Immunochromatography, and Enzyme-linked Immunosorbent assay (ELISA). To understand different techniques used in Chikungunya diagnosis viz., virus culture, partial sequencing along with Immunochromatography and ELISA.
Methods: This is a prospective, laboratory-based study at a tertiary care center. Lateral flow chromatography and ELISA was carried out on serum samples. All 50 samples were cultured and indirect Immunofluorescence was performed on positive samples at Interactive Research School for Health Affairs (IRSHA), Bharati Vidyapeeth Medical College Pune, Maharashtra, India. Virus isolates were subjected to partial sequencing for identification of genotype after confirmation by PCR. Statistical Package of Social Science (SPSS) version 22.0 software was used to calculate the Receiver operating curve (ROC) for different tests.
Results: Out of 50 samples, 20 were positive by Immunochromatography, 23 by ELISA, and 3 by culture, PCR confirmed CHIKV isolates and sequencing identified genotypes as East Central South African type.
Interpretation & conclusion: CHIKV culture isolates of East Central South African type lineage were predominantly found in the present study. These are also common genotypes present in Asia including India.
Keywords: CHIKV; Virus culture; partial sequencing; genotype; ELISA; Lateral flow chromatography
Chikungunya virus (CHIKV) is member of Semliki forest group, of Togaviridae family and genus Alphavirus[1]. It is an enveloped alphavirus of 60–70 nm diameter and 11.8 kb long single-stranded positive-sense RNA genome including two open reading frames (ORFs), that encodes five structural and four non-structural proteins[2]. CHIKV has also been classified into three distinct genotypes, namely Asia; East/Central/South Africa (ECSA) and West African[3]. Chikungunya fever is a re-emergent arthropod-borne (arbovirus) illness caused by CHIKV, transmitted by Culicine mosquitoes Aedes aegypti, Ae. albopictus, and Ae. polynesiensis[4]. It is also transmitted rarely by Anopheles stephensi mosquito[4]. Its name originated from a word in the Kimakonde language, meaning "to become contorted", and describes the stooped appearance of sufferers with joint pain (arthralgia)[5]. First reported in 1953 from Litecho city, Tanzania, now several outbreaks have been reported across the globe[6]. The first case from India was reported from Calcutta in 1963[7]. Over 180,000 cases have been reported in India since December 2005. The virus is said to be widely spread in the Americas, Asia, and Africa in 2019[8],[9]. As per a recent update on 17 January 2020, Brazil, and Thailand have reported the majority of new cases.
CHIKV and dengue virus (DENV) shows overlapping clinical manifestations and are transmitted by the same vectors with similar epidemiology and geographic manifestation[10]. CHIKV culture data is limited, particularly from tertiary care centers in Western Maharashtra and it remains a big challenge to definitively diagnose CHIKV infection in laboratories with poor infrastructure.
Routinely, serology is the main tool used in most Indian laboratories and genotype data is never known due to lack of infrastructure. As per the epidemiological data, CHIKV isolates obtained from India during 1963 and 1973 belonged to Asian genotypes, but Indian Ocean Lineage (IOL) has also re-emerged from the ECSA genotype[11]. The evolution of a new genotype is said to be due to microevolutionary changes in the CHIKV genome[11].
The present study was undertaken for assessing the utility of rapid chromatography and ELISA and to understand rarely used techniques of viral culture in diagnosing CHIKV infection.
MATERIAL & METHODSA prospective laboratory-based study was conducted for one year at a tertiary care center. Fifty blood samples of acute febrile illness cases with rash s/o Chikungunya infection and negative for other arboviral serology were included in the study. Those positive for other arboviruses like DENV (Dengue Virus) were excluded from the study.
Lateral flow chromatography (Advent Chikungunya) [12] and ELISA (Immucheck, IgM ELISA)[13] was carried out on all serum samples as per the manufacturer
's instructions. For isolation of the Chikungunya virus, Vero cells were seeded in 6 well (Corning costar) plates at a density of 5 × 105 cells in 1000 μl in MEM containing 2% FBS. 24 h post seeding 100 μl anti-Chikungunya-IgM. Positive serum samples were added to the cells. Cells were observed daily of cytopathic effect (CPE) under a microscope [Figure 1] & [Figure 2].
Figure 2: Cytopathic effect after 72 h. Complete detachment and rounding of the cells could be seen because of CHIKV infection.Aliquots of supernatant of Vero cells having CPE were collected and stored at -80°C until use. The cells were maintained in 75 cm[2] cell culture flasks (Corning costar) at 37°C with 5% CO2. Subculture was done when cells were 85–90% confluent and the medium was changed the second day after sub-culturing. For cell subculture, cells were detached using trypsin-EDTA (0.25%/0.03% in PBS) and a 1:4 split ratio was maintained. Indirect Immunofluorescence was performed on positive samples for confirmation of Chikungunya. Virus isolates were subjected to partial sequencing for identification of genotype after confirmation by PCR.
RNA extraction
Total RNA was extracted from 140μl of cell culture isolates using a QIAmp viral RNA kit (QIAGEN, INC, Valencia, USA), as per the manufacturer's protocol. RNA was eluted in 50μl of elution buffer provided with the kit. For a conventional gel-based PCR, a minimum of one negative control for every four samples with no presence of target RNA was included as a part of the extraction procedure.
RT-PCR for detection of CHIKV viruses in clinical samples
Detection of Chikungunya virus was based on the amplification of the E region of the viral genome. CHIKV-specific viral RNA was detected by the RT-PCR method using primers specific to the E gene. For this, single-stranded cDNA was synthesized from total RNA using the high-capacity cDNA reverse transcription kit. Briefly, 10μl of the extracted RNA was added to the 2 X RT master mix consisting of 2μl of 10X RT buffer, 0.8μl of 100mM dNTP mix, 2μl of reverse primer R24 (TAT CGC CAA ATT GTC CTG GT) and l μl of MultiScribe reverse transcriptase. The reaction was then subjected to reverse transcription at 25°C for 1 min, 37°C for 120 min and 85°C for 5 min. The prepared cDNA was immediately used or stored at -20°C until use.
PCR and sequencing
Amplification of the E gene was done using the AmpliTaq polymerase kit (Invitrogen). 5μl of the synthesized cDNA was then added to the PCR mix containing 10μ1 of PCR buffer, 10μ1 of MgCl2, 5μ1 of primers F23 (TGGTACTGGAGATGGAGCTAC T), and R23 each, 0.5μl dNTPs, 1μl of polymerase. The reaction mixture was then subjected to 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 1 min. The products were then visualized for ~527bp by ethidium bromide agarose gel staining [Figure 3]. Amplified products were then extracted from the gels using a Qiaquick Gel extraction kit (QIAGEN, INC, Valencia, USA) and both strands were sequenced by using a Big Dye Terminator Cycle Sequencing kit (Applied Biosystems).
Statistical methods
Statistical package of Social Science (SPSS) version 22.0 software was used to calculate Receiver operating curve (ROC) for different tests and Area under the curve was calculated for test variables like Lateral flow Immunochromatography and Viral culture.
Ethical statement
Approval for this study was taken from Institution's Ethics Committee.
ResultsOut of 50 samples, 20 were positive by Immunochromatography, 23 by ELISA, and three by culture. PCR was used for confirmation of CHIKV isolates and sequencing was done to identify genotypes [Figure 3]. All three isolates were of East Central South African type. The sensitivity of Lateral flow chromatography was 25% and specificity was 60%. Positive predictive value of 29% (95% CI 14.78% to 50.03%) and negative predictive value of 54.55% (95% CI44.91% to 63.85%). [Table 1]. The sensitivity of viral culture was 15% and specificity 100%. Positive predictive value of 100%. Negative predictive value of 63% (95% CI -59-67%), Accuracy was 66% [Table 2].
The area under the curve was calculated for Lateral flow Immunochromatography demonstrating that 42.5% of cases were correctly classified by this test [Figure 4]. As per the Area under curve calculation for viral culture, 57.5% of cases were correctly classified by it [Figure 5].
DiscussionDetection of Chikungunya infection is challenging in resource-poor settings, as all tests needed to confirm the diagnosis may not be available. The patient may approach hospitals at variable phases of illness, either acute or convalescent phase, depending upon the severity of symptoms and level of tolerance to these symptoms, causing different time intervals of sample collection which can adversely affect the diagnostic workup of CHIKV infection. CHIKV viremia is present in the patient between the first five to six days after initial infection, thus, culture, antigen detection test, or Polymerase chain reaction (RT-PCR) are useful in the first week. Whereas IgM immune response develops after 6 days of the initial manifestation of CHIKV infection, which can be detected by IgM ELISA and in later weeks, in convalescent phase paired samples can be helpful to show a fourfold increase in IgG titers in patient's sera.
In the present study, samples from patients suspected of CHIKV infection were sent by a clinician using the CHIKV case definition. The patient presented with acute illness (up to 3 weeks) with fever and polyarthralgia were tested for Rapid Immunochromatography, (Advent test detecting IgM antibody against CHIKV), ELISA (Immunocheck detecting only IgM Antibody) and culture. Convalescent phase samples were difficult to collect so IgG antibody testing was not included in the study, although that would have been helpful to show a 4-fold rise in antibody titer in patient samples. Twenty serum samples were detected positive by rapid Immunochromatography test giving poor sensitivity of 25% and specificity of 60%. Performance characteristics of rapid tests vary with manufacturers and lack of specificity can be attributed to cross-reactivity with other alphaviruses, therefore limiting their use diagnosis of CHIKV infections. Many rapid tests for anti-CHIKV IgM and IgG are available like SDBioline and Onsite Chik, but have shown low sensitivity and specificity. Fumagalli et al. showed 82.66% sensitivity, and a specificity of 100% by rE2 CHIKV ELISA[1].
CHIKV was isolated from 3 samples with poor sensitivity of 15% and 100% specificity, a positive predictive value of 100%, and a negative predictive value of 63% where accuracy was 66%. Poor sensitivity of culture could be attributed to varied times of sample collection. Virus isolation despite showing high specificity and considered the gold standard for CHIKV diagnosis, due to requirements of biosafety level 3 laboratory[14] and inverted microscope, cannot be routinely used in diagnosis. Nevertheless, viral culture allows isolates to be used for further identification of strain and mutation studies, e.g., the E1-A226V mutation increases the adaptability of CHIKV to Aedes albopictus mosquitoes[15]. High titers of CHIKV are detectable in the patient's serum or plasma samples between 2 and 6 days following the onset of illness and start decreasing from day five after the onset of illness[16]. Polymerase chain reaction (PCR) is immensely helpful in the acute phase of illness and viral RNA can be detected between 5–8 days of illness. But it may not be accessible and cost-friendly to all patients.
Three genotypes, of CHIKV, are known, namely, West African (WA), Asian, and East Central South Africa (ECSA) genotypes. Indian Ocean Lineage (IOL) was identified in 2004 as a descendant of the ECSA lineage of genotype ECSA[17]. Sequencing of PCR isolate in our study showed, East Central South Africa (ECSA) genotypes, as also shown in earlier studies, circulation of ECSA lineage and IOL lineage of genotype ECSA are the most common genotype reported from South Asian countries after 2011[18],[19]. The most important clades in context to public health impact are the Asian lineage (including Asian/American), the IOL sub-lineage, some other ECSA lineage strains responsible for African outbreaks & multiple CHIKV outbreaks over the last 15 years in Asia, and Africa[20],[21].
Viral culture despite having excellent specificity lacks sensitivity due to the variable sample collection period in suspected cases. Lateral flow chromatography showed better negative predictive value than positive predictive value but the performance of ELISA in terms of positivity was better than other tests.
ConclusionEast Central South Africa (ECSA) genotype was the most common lineage found in this study which was also a predominant lineage circulating in India. Although the sample size is small so it needs further ongoing surveillance to confirm the findings of the study. In resource-poor settings, standard algorithms are difficult to follow but ELISA can be used in the initial workup along with a molecular test for better diagnostic yield.
Conflict of interest: None
AcknowldegementsKey message
Serological tests need to be correlated with the time of sample collection and cross-reactivity with other arboviruses should also be considered. Viral culture and genotyping are necessary to understand the virulence of strains in circulation.
References
留言 (0)