Figure 1. Representative images of lipid droplets observations using hematoxylin-eosin in the epididymal white adipose tissue and liver (A), adipocytes area in the epididymal white adipose tissue, lipid droplets in the liver (B), and representative images of Sirius red staining in the liver (C) from mice. C57BL/6J mice were fed an AIN-93G (CON), high-fat diet (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) diet for 12 weeks. All data are expressed as the mean ± standard deviation. Different letters (a > b > c) indicate a significant difference among treatments. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level (n = 8).

Figure 1. Representative images of lipid droplets observations using hematoxylin-eosin in the epididymal white adipose tissue and liver (A), adipocytes area in the epididymal white adipose tissue, lipid droplets in the liver (B), and representative images of Sirius red staining in the liver (C) from mice. C57BL/6J mice were fed an AIN-93G (CON), high-fat diet (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) diet for 12 weeks. All data are expressed as the mean ± standard deviation. Different letters (a > b > c) indicate a significant difference among treatments. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level (n = 8).

Figure 2. Relative mRNA expression of fibrotic factors α-SMA, Col1a1, and TGF-β (A) and pro-inflammatory cytokines IL-1β, IL-6, and TNF-α (B) and relative mRNA and protein expression of ACC1 (C), FAS (D), and HSL (E) in the livers of mice. C57BL/6J mice were fed a high-fat diet (HF; AIN-93G with 60 kcal% fat) or a high-fat diet with 10% sucrose water (HFS) for 12 weeks. All data are expressed as the mean ± standard deviation. Statistical analyses were performed using Student’s t-test (n = 3, HF vs. HFS; **, p < 0.01, ***, p < 0.001). α-SMA, alpha-smooth muscle actin; Col1a1, collagen type 1 alpha 1; TGF-β, transforming growth factor-beta; IL-1β, interleukin-1 beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; ACC1, acetyl-CoA carboxylase 1; FAS, fatty acid synthase; HSL, hormone-sensitive lipase.

Figure 2. Relative mRNA expression of fibrotic factors α-SMA, Col1a1, and TGF-β (A) and pro-inflammatory cytokines IL-1β, IL-6, and TNF-α (B) and relative mRNA and protein expression of ACC1 (C), FAS (D), and HSL (E) in the livers of mice. C57BL/6J mice were fed a high-fat diet (HF; AIN-93G with 60 kcal% fat) or a high-fat diet with 10% sucrose water (HFS) for 12 weeks. All data are expressed as the mean ± standard deviation. Statistical analyses were performed using Student’s t-test (n = 3, HF vs. HFS; **, p < 0.01, ***, p < 0.001). α-SMA, alpha-smooth muscle actin; Col1a1, collagen type 1 alpha 1; TGF-β, transforming growth factor-beta; IL-1β, interleukin-1 beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; ACC1, acetyl-CoA carboxylase 1; FAS, fatty acid synthase; HSL, hormone-sensitive lipase.

Figure 3. Relative mRNA expression of pro-inflammatory cytokines, IL-1β, IL-6, and TNF-α (A), SREBP1C, and C/EBP-β (B), relative mRNA and protein expression of ACC1 (C) and FAS (D), and protein expression of FABP4 (E) and HSL (F) in the epididymal white adipose tissue of mice. C57BL/6J mice were fed a high-fat diet (HF; AIN-93G with 60 kcal% fat) or a high-fat diet with 10% sucrose water (HFS) for 12 weeks. All data are expressed as the mean ± standard deviation. Statistical analyses were performed using Student’s t-test (n = 3, HF vs. HFS; *, p < 0.05, **, p < 0.01, ***, p < 0.001). IL-1β, interleukin-1 beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; SREBP1C, sterol regulatory element-binding protein-1C; C/EBP-β, CCAAT/enhancer-binding protein-beta; ACC1, acetyl-CoA carboxylase 1; FAS, fatty acid synthase; FABP4, fatty acid-binding protein 4, HSL, hormone-sensitive lipase.

Figure 3. Relative mRNA expression of pro-inflammatory cytokines, IL-1β, IL-6, and TNF-α (A), SREBP1C, and C/EBP-β (B), relative mRNA and protein expression of ACC1 (C) and FAS (D), and protein expression of FABP4 (E) and HSL (F) in the epididymal white adipose tissue of mice. C57BL/6J mice were fed a high-fat diet (HF; AIN-93G with 60 kcal% fat) or a high-fat diet with 10% sucrose water (HFS) for 12 weeks. All data are expressed as the mean ± standard deviation. Statistical analyses were performed using Student’s t-test (n = 3, HF vs. HFS; *, p < 0.05, **, p < 0.01, ***, p < 0.001). IL-1β, interleukin-1 beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; SREBP1C, sterol regulatory element-binding protein-1C; C/EBP-β, CCAAT/enhancer-binding protein-beta; ACC1, acetyl-CoA carboxylase 1; FAS, fatty acid synthase; FABP4, fatty acid-binding protein 4, HSL, hormone-sensitive lipase.

Figure 4. Identification and quantification of secreted liver-derived exosomes. Size distribution (A), images for isolated liver-derived exosomes (Scale bar = 500 nm) (B), expression of the exosome marker CD63 (C). Red fluorescence-labeled liver-derived exosome uptake in 3T3-L1 cells. Representative fluorescence microscope images show the distribution of liver-derived exosomes, as indicated by the PKH-26 red fluorescent dye, whereas cell nuclei were stained with DAPI (blue) (Scale bar = 50 μm) (D).

Figure 4. Identification and quantification of secreted liver-derived exosomes. Size distribution (A), images for isolated liver-derived exosomes (Scale bar = 500 nm) (B), expression of the exosome marker CD63 (C). Red fluorescence-labeled liver-derived exosome uptake in 3T3-L1 cells. Representative fluorescence microscope images show the distribution of liver-derived exosomes, as indicated by the PKH-26 red fluorescent dye, whereas cell nuclei were stained with DAPI (blue) (Scale bar = 50 μm) (D).

Figure 5. Protein content of liver-derived exosomes in livers of equal weight (A) and total liver weight (B) for mice and TG levels of liver-derived exosomes in equal amounts of exosomes (C) and total exosomes (D). C57BL/6J mice were fed an AIN-93G (CON), high-fat (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) for 12 weeks. All data are expressed as the mean ± standard deviation. Different letters (a > b) indicate a significant difference among treatments. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level (n = 8). TG, triglyceride.

Figure 5. Protein content of liver-derived exosomes in livers of equal weight (A) and total liver weight (B) for mice and TG levels of liver-derived exosomes in equal amounts of exosomes (C) and total exosomes (D). C57BL/6J mice were fed an AIN-93G (CON), high-fat (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) for 12 weeks. All data are expressed as the mean ± standard deviation. Different letters (a > b) indicate a significant difference among treatments. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level (n = 8). TG, triglyceride.

Figure 6. Triglyceride levels in differentiated 3T3-L1 cells treated with liver-derived exosomes from mice. C57BL/6J mice were fed an AIN-93G (CON), high-fat (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) for 12 weeks. Cells were treated with 50 µg/mL of liver-derived exosomes from the CON (CON-Exo), 50 µg/mL exosomes from the HF (HF-Exo), 50 µg/mL exosomes from the HFS (HFS-Exo), 122.5 µg/mL exosomes from the HF (HF-ExoR), and 121.5 µg/mL exosomes from the HFS (HFS-ExoR) groups. The levels of HF-ExoR and HFS-ExoR were obtained from the differential ratio to normalize the values to the weight of liver tissue. All data are expressed as the mean ± standard deviation. Different letters (a > b > c) indicate significant differences among CON-Exo, HF-ExoR, and HFS-ExoR. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level. Statistical analyses were performed using Student’s t-test (n = 3, Exo vs. ExoR; **, p < 0.01, ***, p < 0.001).

Figure 6. Triglyceride levels in differentiated 3T3-L1 cells treated with liver-derived exosomes from mice. C57BL/6J mice were fed an AIN-93G (CON), high-fat (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) for 12 weeks. Cells were treated with 50 µg/mL of liver-derived exosomes from the CON (CON-Exo), 50 µg/mL exosomes from the HF (HF-Exo), 50 µg/mL exosomes from the HFS (HFS-Exo), 122.5 µg/mL exosomes from the HF (HF-ExoR), and 121.5 µg/mL exosomes from the HFS (HFS-ExoR) groups. The levels of HF-ExoR and HFS-ExoR were obtained from the differential ratio to normalize the values to the weight of liver tissue. All data are expressed as the mean ± standard deviation. Different letters (a > b > c) indicate significant differences among CON-Exo, HF-ExoR, and HFS-ExoR. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level. Statistical analyses were performed using Student’s t-test (n = 3, Exo vs. ExoR; **, p < 0.01, ***, p < 0.001).

Figure 7. Relative mRNA expression of pro-inflammatory cytokines, IL-1β, IL-6, and TNF-α (A), ACC1, FAS (B), SREBP1C, and C/EBP-β (C) in differentiated 3T3-L1 cells treated with liver-derived exosomes for 48 h. C57BL/6J mice were fed an AIN-93G (CON), high-fat (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) for 12 weeks. Cells were treated with 50 µg/mL of liver-derived exosomes from the CON (CON-Exo), 50 µg/mL exosomes from the HF (HF-Exo), 50 µg/mL exosomes from the HFS (HFS-Exo), 122.5 µg/mL exosomes from the HF (HF-ExoR), and 121.5 µg/mL exosomes from the HFS (HFS-ExoR) groups. The amounts of HF-ExoR and HFS-ExoR were obtained from the differential ratio to normalize the values to the weight of liver tissue. All data are expressed as the mean ± standard deviation. Different letters (a > b > c > d > e) indicate a significant difference among treatments. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level (n = 3). IL-1β, interleukin-1 beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; ACC1, acetyl-CoA carboxylase 1; FAS, fatty acid synthase; SREBP1C, sterol regulatory element-binding protein-1C; C/EBP-β, CCAAT/enhancer-binding protein-beta.

Figure 7. Relative mRNA expression of pro-inflammatory cytokines, IL-1β, IL-6, and TNF-α (A), ACC1, FAS (B), SREBP1C, and C/EBP-β (C) in differentiated 3T3-L1 cells treated with liver-derived exosomes for 48 h. C57BL/6J mice were fed an AIN-93G (CON), high-fat (HF; AIN-93G with 60 kcal% fat), or high-fat diet with 10% sucrose water (HFS) for 12 weeks. Cells were treated with 50 µg/mL of liver-derived exosomes from the CON (CON-Exo), 50 µg/mL exosomes from the HF (HF-Exo), 50 µg/mL exosomes from the HFS (HFS-Exo), 122.5 µg/mL exosomes from the HF (HF-ExoR), and 121.5 µg/mL exosomes from the HFS (HFS-ExoR) groups. The amounts of HF-ExoR and HFS-ExoR were obtained from the differential ratio to normalize the values to the weight of liver tissue. All data are expressed as the mean ± standard deviation. Different letters (a > b > c > d > e) indicate a significant difference among treatments. Multiple comparisons of means were performed using Duncan’s multiple range test at the 0.05 significance level (n = 3). IL-1β, interleukin-1 beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; ACC1, acetyl-CoA carboxylase 1; FAS, fatty acid synthase; SREBP1C, sterol regulatory element-binding protein-1C; C/EBP-β, CCAAT/enhancer-binding protein-beta.

Table 1. Primer sequences used in real-time PCR quantification of mRNA.

Table 1. Primer sequences used in real-time PCR quantification of mRNA.

GenePrimer SequencesACC1F: 5′-GATGAACCATCTCCGTTG-3′R: 5′-CCCAATTATGAATCGGGA-3′FASF: 5′-ACTGCCTTCGGTTCAGTCTC-3′R: 5′-CACCCTCCAAGGAGTCTCAC-3′SREBP1CF: 5′-TGAAGACAGATGCAGGAG-3′R: 5′-ATGGTCCCTCCACTCACC-3′C/EBP-βF: 5′-GACAAGCTGAGCGACGAG-3′R: 5′-GTCAGCTCCAGCACCTTG-3′IL-1βF: 5′-GCCACCTTTTGACAGTGATG-3′R: 5′-ATCAGGACAGCCCAGGTCAA-3′IL-6F: 5′-CCAAGAGATAAGCTGGAGTCA-3′R: 5′-GCACTAGGTTTGCCGAGTAGA-3′TNF-αF: 5′ AAGTTCCCAAATGGCCTCCC 3′R: 5′-TTTGCTACGACGTGGGCTAC-3′α-SMAF: 5′-TCACCATTGGAAACGAACGC-3′R: 5′-GCTGTTATAGGTGGTTTCGT-3′Col1a1F: 5′-AGCACGTCTGGTTTGGAGAG-3′R: 5′-GACATTAGGCGCAGGAAGGT-3′TGF-βF: 5′-CATCCATGACATGAACCGGC-3′R: 5′-GTTGGTATCCAGGGCTCTCC-3′ACS1F: 5′-CCGCGACTCCTTAAATAGCA-3′R: 5′-GGGTTGGTGGTTCTCTATGC-3′HSLF: 5′-GTGAATGAGATGGCGAGGGT-3′R: 5′-GTGCCCTCACAGCAGGAATA-3′FABP4F: 5′-TGGGATGGAAAGTCGACCAC-3′R: 5′-TTCTTTGGCTCATGCCCTT-3′GAPDHF: 5′-AACTTGGCATTGTGGAAGG-3′R: 5′-CACATTGGGGGTAGGAACAC-3′

Table 2. Changes in BW, diet intake, FER, and organ weight from mice fed a conventional normal, HF, and HFS diet.

Table 2. Changes in BW, diet intake, FER, and organ weight from mice fed a conventional normal, HF, and HFS diet.

CON (n = 8)HF (n = 8)HFS (n = 8)BW (g)Initial (0 weeks)20.88 ± 0.6 NS20.46 ± 0.920.14 ± 0.7Final (12 weeks)32.16 ± 2.0 c46.30 ± 2.7 a41.65 ± 4.1 bWeight gain (g)11.27 ± 2.4 c25.83 ± 2.5 a21.51 ± 3.8 bDiet intake (g)239.91 ± 3.1 NS230.56 ± 2.6218.76 ± 3.3Sucrose water intake (mL)--251.69 ± 4.9Total calorie intake (kcal) 1904.4 ± 44.58 b1164.9 ± 48.63 a1154.8 ± 60.99 aFER 21.24 ± 0.06 a2.22 ± 0.09 c1.87 ± 0.1 bLiver (g)1.01 ± 0.1 c2.09 ± 0.3 a1.59 ± 0.4 bTotal WAT (g)2.94 ± 0.8 b6.74 ± 1.4 a6.02 ± 0.8 aEpididymal WAT (g)1.12 ± 0.2 b2.03 ± 0.3 a2.15 ± 0.2 aVisceral WAT (g)0.52 ± 0.2 b1.14 ± 0.3 a1.00 ± 0.2 aSubcutaneous WAT (g)1.29 ± 0.3 c3.56 ± 0.7 a2.88 ± 0.3 bLiver weight/BW (%)3.18 ± 0.2 b4.5 ± 0.6 a3.78 ± 0.9 bTotal WAT weight/BW (%)9.06 ± 1.9 b14.62 ± 2.6 a14.56 ± 1.1 a

Table 3. Levels of serum triglyceride, total cholesterol, LDL, HDL, glucose, AST, and ALT in mice fed a conventional normal, HF, and HFS diet.

Table 3. Levels of serum triglyceride, total cholesterol, LDL, HDL, glucose, AST, and ALT in mice fed a conventional normal, HF, and HFS diet.

CON (n = 8)HF (n = 8)HFS (n = 8)Triglyceride (nmol/μL)6.52 ± 0.30 c8.39 ± 0.45 b10.35 ± 0.32 aTotal cholesterol (μg/μL)82.97 ± 4.9 c109.98 ± 4.71 a98.83 ± 6.04 bLDL (μg/μL)0.15 ± 0.01 c0.32 ± 0.01 a0.23 ± 0.01 bHDL (μg/μL)0.12 ± 0.02 b0.27 ± 0.02 a0.26 ± 0.02 aGlucose (nmol/μL)1.8 ± 0.08 c2.9 ± 0.1 b3.5 ± 0.02 aAST (U/mL)2.9 ± 1.0 c4.3 ± 1.1 ab5.4 ± 1.5 aALT (mU/mL)0.46 ± 0.05 b1.7 ± 0.11 a1.59 ± 0.05 a