Viruses and cells

SARS-CoV-1 and SARS-CoV-2 (lineage B βCoV), MERS-CoV (lineage C βCoV), hCoV-OC43 (lineage A βCoV), and hCoV-229E (αCoV) were included in this study to represent the subgroups of CoVs that cause human infections. The WT SARS-CoV-2 HKU-001a (GenBank accession number MT230904), B.1.1.7/Alpha (GISAID: EPI_ISL_1273444), B.1.351/Beta (GISAID: EPI_ISL_2423556), B.1.617.2/Delta (GISAID: EPI_ISL_3221329), and B.1.1.529/Omicron (GISAID accession number EPI_ISL_7138045) strains were isolated from respiratory tract specimens of laboratory-confirmed COVID-19 patients in Hong Kong (Yuan et al. 2021). MERS-CoV (EMC/2012) was kindly provided by Ron Fouchier (Erasmus Medical Center, the Netherlands). Archived clinical strains of SARS-CoV-1 (GZ50 strains, GenBank accession number: AY304495), HCoV-OC43, and HCoV-229E were obtained from the Department of Microbiology, The University of Hong Kong (HKU). All the cell lines used in this study, except for HEL (human embryonic lung fibroblasts; in-house development), were obtained from American Type Culture Collection. Cardiomyocytes derived human embryonic stem cells (CM) were prepared as we previously described (Yuan et al. 2021). The inhibitory activity of F0213 against 229E replication were tested in HEL cells and OC43 in BSC-1 cells.

Chemical reagents

The SmartTM chemical library was purchased from Chemdiv (San Diego, USA), which contains 50,080 small-molecule compounds with enhanced diversity and drug-like properties. Remdesivir and its prodrug GS-441524, as well as GRL0617 were purchased from MedChemExpress (NJ, USA). Arg-Leu-Arg-Gly-Gly-AMC (RLRGG-AMC) was purchased from Bachem Bioscience (Bubendorf, Switzerland). ISG15-AMC, ubiquitin-AMC, and HA-Ub-VS were purchased from R&D systems (Minneapolis, USA). Cellular protease assay kit (Cat# 539125) was purchased from Sigma-Aldrich. CellTiter-Glo cell viability assay kit was purchased from Promega. Other chemicals were purchased from Sigma-Aldrich unless specified.

PLpro phylogenetic analysis

Nsp3 PLpro protein sequence alignments and phylogenetic trees were generated using Clustal Omega (Sievers and Higgins 2018), Mega X (Kumar et al. 2018) and visualized using ggtree (Yu et al. 2018). Protein similarity and BLOcks SUbstitution Matrix 62 (BLOSUM62) score were calculated using BLOSUM62 matrix (Gu et al. 2016). The accession numbers used were as follows: PDCoV (KR265858), hCoV-229E (JX503060), hCoV-HKU1 (DQ415904), hCoV-NL63 (JX504050), hCOV-OC43 (AY903460), HKU5-1 (NC_009020), MERS-CoV (JX869059), HKU9-4 (EF065516), HKU3-1 (DQ022305), SHC014 (KC881005), WIV1 (KF367457), SARS-CoV (AY278741) and SARS-CoV-2 (NC_045512).

Viral load reduction assay

Viral load reduction assay was performed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) as we described previously with slight modifications (Yuan et al. 2020). Briefly, RNA was extracted from culture supernatants of the CoV-infected cell lines as mentioned above using the MiniBEST Viral RNA/DNA Extraction Kit (Takara Bio Inc., Kusatsu, Shiga Prefecture, Japan). Reverse transcription was performed with the Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland) with oligo-dT primers. To determine the virus genome copies, qPCR was performed using the LightCycler 480 SYBR Green I Master Mix (Roche) with specific primers. hCoV-229E_Forward: CTACAGATAGAAAAGTTGCTTT; hCoV-229E_Reverse: GGTCGTTTAGTTGAGAAAAGT; hCoV-OC43_ Forward: AAACGTGCGTGCATC; hCoV-OC43_ Reverse: AGATTACAAAAAGATCTAACAAGA; hCoV-NL63_ Forward: GGAGATAGAGAATTTTCTTATTTAGA; hCoV-NL63_ Reverse: GGTTTCGTTTAGTTGAGAAG. The virus genome copies in supernatant samples were quantified with a standard.

Plaque reduction assay

Plaque reduction assay was performed in 24-well tissue culture plates as we described previously with slight modifications (Yuan et al. 2020). Briefly, Vero cells were seeded at 1 × 105 cells/well in MEM (Invitrogen, Carlsbad, CA, USA) with 10% FBS on the day before the assay was carried out. After 16–24 h of incubation, 70–100 plaque-forming units (PFU) of SARS-CoV-2 or MERS-CoV was added to the cell monolayer with or without the addition of drug compounds and the plates further incubated for 2 h at 37 °C in 5% CO2 before removal of unbound viral particles by aspiration of the media and washing once with MEM. The cell monolayers were then overlaid with media containing 1% low melting agarose (Cambrex, East Rutherford, NJ, USA) in MEM and appropriate concentrations of the drug compounds and incubated as above for 72 h. Next, the wells were fixed with 10% formaldehyde overnight. After removal of the agarose plugs, the cell monolayers were stained with 0.7% crystal violet and the plaques counted. The percentage of plaque inhibition relative to the control (0.1% DMSO) plates was determined for each drug compound concentration.

Expression and purification of PLpro

Recombinant SARS2-PLpro from the reference sequence Wuhan-Hu-1 (GenBank ID YP_009724390.1) (wild type) and each with point mutation of C111S, K157A, D164A, Y264A, Y268A or Q269A were codon-optimized and clone into pET28b+ expressed and purified in E. coli as we described previously with modifications (Yuan et al. 2016). MERS-PLpro (GenBank: JX869059.2) were expressed in the same way, including point mutation of S165A, H169A, V208A, P248A, F267A, E271A or Y277A, individually. The constructs were fused with an N-terminal 6× His tag for purification. The overexpression of the PLpro was induced by 0.1 mmol/L of IPTG at 16 °C for 16 h with agitation at 250 rpm. The concentration of purified PLpro was determined by using the Bradford Assay Kit (Bio-Rad) according to the manufacturer’s instructions. The purity of each recombinant PLpro mutant protein was verified by SDS-PAGE.

Molecular docking

Crystal structures of SARS-CoV-2 and MERS-CoV papain-like protease (PLpro) used for molecular docking was retrieved from the Protein Data Bank (PDB) ID 7JRN and 4RNA21, respectively. Coordinate of the compound F0213 was downloaded from PubChem (Kim et al. 2021). Preparation of the macromolecules PLpro and the ligand F0213 for molecular docking was carried out using software AutoDockTools following standard protocols. The molecular docking was performed using program Autodock Vina with default parameters. Presentation of PLpro/F0213 interactions was generated using software PyMOL (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC) with academy licenses.

Protease cleavage assay

To explore the cleavage inhibition of PLpro against ISG15 and ubiquitin, ubiquitin–AMC or ISG15–AMC were used as substrate of PLpro and the release of AMC was measured by increase of fluorescence (excitation/emission, 360/487 nm) on a 384-well microplate reader (PHERAstar FSX, BMG Labtech). Twenty-five microlitres of solution containing different concentrations of F0213 (final concentrations range from 100 to 0 μmol/L) and 1 μmol/L of ubiquitin-AMC or ISG15-AMC was aliquoted into a 384 well plate with the reaction initiated by addition of 25 μL of PLpro (0.1 μmol/L) to the well. Initial velocities of AMC release was normalized against DMSO control. The IC50 value was calculated by the dose–response–inhibition function in Graphpad Prism with [inhibitor] vs. normalized response equation. GRL-0617 was used as a positive control throughout the experiments.

Reporter gene assay

To analyze the induction of IFN-β induced genes in the presence/absence of PLpro, and with or without F0213 treatment, luciferase reporter assays were performed in 293T cells (Shin et al. 2020). In brief, an expression construct containing the luciferase ORF and the IFN-β promoter (IFN-β-luciferase) or NF-κb or IRF3 was co-transfected with either a pCAGEN control plasmid or the designated PLpro plasmid and Renilla plasmid. For all transfections, 100 ng of luciferase plasmid, 400 ng of PLpro or pCAGEN vector and 5ng Renilla plasmid were used in each well of a 24-well plate. Twenty-four hours after transfection, cells were treated with 500 ng poly(I:C) for 18 h or 50 ng/mL of TNF for 30 min. For the F0213 treatment group, serial diluted concentrations of F0213 was added to relative wells after 6 h poly(I:C) or 50 ng/mL TNF treatment. Luciferase expression was measured using the Luciferase Reporter Assay System (Promega). Fold change was calculated by taking vector treated with poly(I:C) as 1.

Hamster experiment

Male and female Syrian hamster, aged 6–10 weeks old, were kept in biosafety level 3 housing and given access to standard pellet feed and water, as we previously established (Yuan et al. 2021). All experimental protocols were approved by the Animal Ethics Committee in the HKU (CULATR) and were performed according to the standard operating procedures of the biosafety level 3 animal facilities (reference code: CULATR 5370-20). Experimentally, each hamster was intranasally inoculated with 105 PFU of SARS-CoV-2 in 100 µL PBS under intraperitoneal ketamine (200 mg/kg) and xylazine (10 mg/kg) anaesthesia. Six-hour post-virus-challenge, hamsters were intraperitoneally given either F0213 (5 mg/kg), or GS-441524 (40 mg/kg) or vehicle control (2% DMSO in 12% SBE-β-CD) for consecutive 4 days. Animals were monitored twice daily for clinical signs of disease. Six animals in each group were sacrificed at 4 dpi for virological and histolopathological analyses as we previously described (Gu et al. 2016). Viral yield in the lung tissue homogenates was detected by plaque assay and qRT-PCR method, respectively.

Human DPP4-knockin (hDPP4-KI) mouse experiment

The hDPP4 exon 10–12 knockin mice were provided by Dr. Paul McCray (University of Iowa, IA, USA). All experimental protocols were approved by the CULATR and were performed according to the standard operating procedures of the biosafety level 3 animal facilities (reference code: CULATR 5193-19). Littermates of the same sex were randomly assigned to experimental groups. On the day of infection, the mice were intranasally inoculated with 2000 PFU mouse-adapted MERS-CoV (MERS-CoVMA) as we previously described (Chu et al. 2021). Infected mice received same regimen as that of hamster experiment except the increasing dose of F0213 (20 mg/kg). Body weight of each mouse was monitored on daily basis for 14 days or until death. Virological analyses were performed after mice were sacrificed on 3 dpi.

Isothermal titration calorimetry (ITC)

The binding affinity between SARS2-PLpro and F0213 or GRL0617 was measured under 25 °C through isothermal titration calorimeter (MicroCal iTC200, Malvern Panalytical) as we previously described (Gao et al. 2018). Both the protein and inhibitor were dissolved in the buffer containing 20 mmol/L HEPES, pH = 7.4, 150 mmol/L NaCl and 0.8% DMSO. The protein concentration in syringe ranged from 0.25 to 0.5 mmol/L while in reaction cell ranged from 0.03 to 0.06 mmol/L. The competition experiment was performed using the same conditions, except that the SARS-PLpro was pre-incubated with F0213 or GRL0617 at molar ratio 1:1. All titration data was calculated and analyzed by using a single-site binding model for nonlinear curve fitting in MicroCal ITC-ORIGIN Analysis Software (Malvern Panalytical). ITC titration was repeated at least twice for each experiment.

Generation of recombinant MERS-CoV with NSP3 E271A mutation

Reverse genetic to generate recombinant MERS-CoV was performed as we previously described (Wong et al. 2020). MERS-CoV (EMC/2012) molecular clone in pBeloBAC11 backbone was kindly provided by Professor Luis Enjuanes (Spanish National Center for Biotechnology, Madrid, Spain). The point mutation (E271A) was generated in pBeloBAC11-EMC-2012 BAC using the lambda Red-mediated homologous recombination, followed by transfection to BHK-21 cells. After six hours, the cells were trypsinized and co-cultured with Vero cells to generate recombinant MERS-CoV carrying the NSP3 E271A mutation.