1 INTRODUCTION

Telomere length is maintained around a species-specific equilibrium. Loss of equilibrium length maintenance can result in critically short telomeres that signal cell death, cell cycle arrest, or cellular senescence (di Fagagna et al., 2003; Harley et al., 1990; IJpma & Greider, 2003; Lundblad & Szostak, 1989). In humans, loss of telomere length maintenance and subsequent telomere shortening leads to specific age-associated degenerative diseases such as bone marrow failure and pulmonary fibrosis (Armanios, 2009). Multiple factors contribute to telomere length equilibrium maintenance. First, the components of telomerase, required for telomere elongation, are limiting in cells (Armanios et al., 2005; Mozdy & Cech, 2006; Vulliamy et al., 2004). Having reduced levels of telomerase leads to progressive telomere shortening over many generations. Second, telomere length is regulated by telomere binding proteins through multiple independent mechanisms. In yeast, Tel1 and the Mre11/Rad50/Xrs2 (MRX) complex mediate telomere elongation (Greenwell et al., 1995; Keener et al., 2019; Ritchie & Petes, 2000) and the Rap1/Rif1/Rif2 proteins and the Cdc13/Stn1/Ten1(CST) complex bind telomeres and regulate telomere length (Gao et al., 2007; Marcand et al., 1997; Price et al., 2010). In human cells, the shelterin complex of telomere binding proteins also regulates the ability of telomerase to elongate telomeres (Palm & de Lange, 2008; Smogorzewska & de Lange, 2004).

The different telomere binding complexes that determine telomere length homeostasis are regulated through protein modification. The ATM/ATR (Tel1/Mec1 in yeast) kinases regulate telomere elongation; deletion of both TEL1 and MEC1 in yeast leads to short stable telomeres (Ritchie et al., 1999). The cyclin-dependent kinase Cdk1 regulates the telomere elongation during S phase in the cell cycle (Frank et al., 2006; Li et al., 2009; Liu et al., 2014; Vodenicharov & Wellinger, 2006). Here, we describe a role for the Bur1/2 cyclin-dependent kinase in the regulation of telomeres in the yeast Saccharomyces cerevisiae.

Bur1 is a kinase with homology to cyclin-dependent kinases, and its activity is regulated by the Bur2 cyclin component (Yao et al., 2000). BUR1 is an essential gene, while BUR2 deletion mutants grow slowly, presumably because another cyclin can substitute, though poorly, for Bur2. The Bur1/2 kinase complex is involved in regulating transcriptional elongation at several levels in yeast. First, Bur1/2 regulates Set2, which is a histone methylase specific for H3K36 trimethylation (Chu et al., 2006). Deletion of SET2 rescues the lethality of a BUR1 deletion and improves the growth of BUR2 deletion (Chu et al., 2006), likely by decreasing the methylation of H3K36, since overexpression of histone demethylases also rescues bur1∆ growth (Kim & Buratowski, 2007). In addition to regulation of Set2 H3K36 trimethylation, the Bur1/2 kinase complex regulates transcriptional elongation. The kinase regulates the ubiquitination of histone H2B (Laribee et al., 2005), and it phosphorylates serine 2 on the C-terminal domain (CTD) of RNA polymerase II (Liu et al., 2009; Murray et al., 2001). In addition, the Bur1/2 kinase complex promotes the recruitment of the PAF1 complex through its role as a CTD kinase and by phosphorylation of Spt5 (Qiu et al., 2012). Through these multiple levels of transcriptional regulation, the Bur1/2 complex regulates the mRNA levels of a large number of genes (Laribee et al., 2005).

We identified bur2Δ as having short telomeres from a collection of yeast deletion mutants. We demonstrated that the short telomeres in both bur1 and bur2 mutants were not rescued by SET2 deletion, which rescues the growth defect in these mutants. Telomere elongation in a de novo telomere addition assay was blocked by both bur1 and bur2 mutations. We tested whether the short telomere effect and loss of de novo elongation were due to low levels of TLC1, as previously reported in paf1 mutants (Mozdy et al., 2008), but found instead that overexpression of TLC1 did not rescue telomere elongation. Finally, bur1 mutants were defective in telomere recombination to generate survivors, which occurs in the absence telomerase. Taken together, our data suggest that the Bur1/2 kinase affects telomere elongation independent of its effects on transcription of telomerase components.

2 MATERIALS AND METHODS 2.1 Yeast strains and plasmids

Yeast strains and plasmids are listed in Tables 1 and 2, respectively. Oligonucleotides (primers) for polymerase chain reaction (PCR) and quantitative reverse transcription PCR (qRT-PCR) are listed in Table 3. The haploid MAT a deletion collection of S. cerevisiae BY4741 and the yeast strains containing the histone H3 mutants were gifts from J. Boeke and E. Hyland. Haploid mutants, bur1–1, bur1–8, and a plasmid containing BUR1, were gifts from G. Prelich (Murray et al., 2001). Strains for the de novo telomere addition assay were generated using JHUY877 (Ma & Greider, 2009) by direct transformation followed by tetrad analysis. JHUY887 is the haploid strain derived from dissection of JHUY877. The bur1–8 allele was first backcrossed to YPH500 (Sikorski & Hieter, 1989), followed by mating to JHUY887. The diploid was sporulated to generate wild-type and bur1–8 mutant strains for analysis. Gene replacement at the endogenous locus (Brachmann et al., 1998) was used to generate all deletion mutants in diploid strains, followed by tetrad analysis. Overexpression of TLC1 was done from the inducible galactose promoter with the plasmid pGalTLC1 that was derived from pESC-TRP-TLC1/HAT-EST2, a generous gift from V. Zakian. This plasmid was modified by cutting with EcoRI to remove the HAT tag and 1.3 Kb of the coding region of EST2; after release of this fragment, the plasmid was reclosed at EcoRI. Passaging of this plasmid construct in cells was done in casamino acid supplemented media without tryptophan (CAA). The construction of pBUR1∆C was a derivative of pBUR1 where, by Gibson assembly (Gibson 2011), only the first 365aa were contained in the open reading frame of BUR1. All restriction enzymes, T4 DNA ligase, and Gibson assembly mix used in these experiments were from New England Biolabs (NEB).

TABLE 1. Yeast strains used in this study Strain ID Genotype Source Figure OY249 (JHUY890) MATa his3∆1 leu2∆0 met15∆0 ura3∆0 bur1–8::kanMX4 Prelich gift 1a and 7b GY114 (JHUy891) MATa his4-912δ lys2-128δ suc2∆UAS(-1900/-390) ura-352 ade8 bur1–1 Prelich & Winston, 1993 1a and 7b JHUY761 MATa/MATα his3∆1/his3∆1 leu2∆0/leu2∆0 lys2∆0/lys2∆0 met15∆0/met15∆0 trp1∆63/trp1∆63 ura3∆0/ura3∆0 Ma & Greider, 2009 YCC212, 213 JHUY761 BUR2/bur2∆::LEU2 This study 1a YCC221 MATa his3∆1 leu2∆0 met15∆0 ura3∆0 bur2∆::kanMX4 Winzeler et al., 1999 1a and 3 JHUY896 MATa/MATα his3∆1/his3∆1 leu2∆0/leu2∆ LYS2/lys2∆0 met15∆0/MET15 ura3∆0/ura3∆0 BUR1/bur1–8::kanMX4 This study 1b YCC294 MATa/MATa his3∆1/his3∆1 leu2∆0/leu2∆ LYS2/lys2∆0 met15∆0/MET15 ura3∆0/ura3∆0 BUR1/bur1–8::kanMX4 SET2/set2∆::LEU2 This study 1c YCC241 MATα his3∆1 leu2∆0 lys2∆0 ura3∆0 bur1∆::kanMX4 + pRS426BUR1 This study 1d EMHy201 (YCC237) MATa his3∆200 leu2∆1 lys2∆0 met15∆0 ura3–167 trp1∆63 ade2::his hht1-hhf1hhf1::natMX hht2-hhf2::hygMX4 RDN::mURA3/HIS3 + pBS4 (HHT2:K36A-HHF2) Gift, Hyland et al., 2005 1d JHUY877 MATa-inc/MATα ade2-101/ade2-101 his3∆200/his3∆200 lys2-801/lys2-801 trp1∆63/trp1∆63 ura3-52/ura3-52 leu2∆1/leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4/RAD52 Ma & Greider, 2009 JHUY887 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 This study YCC243 MATα his3∆0 leu2∆0 lys2∆0 met15∆0 bur1–8:KanMX This study YCC265, 266 MATa-inc bur1–8:kanMX4 ade2-101 lys2-801 leu2 his3 ura3 trp1 leu2∆1:GAL1-HO-LEU2 VII-L::ADE2-TG(1-3)-HO SITE-LYS2 rad52∆::hphMX4 This study 2a,b YCC267 MATa-inc BUR1 ade2-101 lys2–801 leu2 his3 ura3 trp1 leu2∆1:GAL1-HO-LEU2 VII-L::ADE2-TG(1-3)-HO SITE-LYS2 rad52::hphMX4 This study 2a,b YCC282 MATa-inc BUR1 ade2-101 lys2-801 leu2 his3 ura3 trp1 leu2∆1:GAL1-HO-LEU2 VII-L::ADE2-TG(1-3)-HO SITE-LYS2 rad52::hphMX4 set2∆::URA3 This study 2c YCC303, 304 MATa-inc bur1–8::kanMX4 ade2-101 lys2-801 leu2 his3 ura3 trp1 leu2∆1:GAL1-HO-LEU2 VII-L::ADE2-TG(1-3)-HO SITE-LYS2 rad52::hphMX4 This study 2c YCC306 MATa-inc BUR1 ade2-101 lys2-801 leu2 his3 ura3 trp1 leu2∆1:GAL1-HO-LEU2 VII-L::ADE2-TG(1-3)-HO SITE-LYS2 rad52::hphMX4 This study 2c YCC328 MATa his3∆200 leu2∆1 lys2∆0 met15∆0 trp1∆63 ura3–167 ade2::hisG hht1-hhf1::natMX4 hht2-hhf2-HHTS-HHFS RDN1::Ty1-MET15 TelV::ADE2 Gift, Hyland et al., 2005 2c YCC336 MATa his3∆200 leu2∆1 lys2∆0 met15∆0 trp1∆63 ura3–167 ade2::hisG hht1-hhf1::natMX4 hht2-hhf2-HHTS:K36A-HHFS RDN1::Ty1-MET15 TelV::ADE2 Gift, Hyland et al., 2005 2c YCC459, 460 MATa-inc/MATα ade2-101/ade2-101 his3∆200/his3∆200 lys2-801/lys2-801 trp1∆63/trp1∆63 ura3-52/ura3-52 leu2∆1/leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4/RAD52 BUR2/bur2∆::kanMX4 SET2/set2∆::URA3 This study YCC468, 469 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 bur2∆::kanMX4 set2∆::URA3 This study 2d YCC466 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 set2∆::URA3 This study 2d YCC379 MATa ura3∆0 lys2∆0 leu2∆0 his3∆1 set2∆::kanMX4 This study 3 YCC380 MATα ura3∆0 leu2∆0 his3∆1 set2∆::kanMX4 bur1∆::LEU2 This study 3 YCC381 MATa ura3∆0 leu2∆0 his3∆1 SET2 BUR1 This study 3 YCC498, 499, 500, 501 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 bur2∆::kanMX4 set2∆::URA3 (lost plasmid pGal1TLC1) This study 4 and 5 YCC502, 503, 504, 505 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 bur2∆::kanMX4 set2∆::URA3 + pGal1TLC1 This study 4 and 5 YCC506, 507 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 BUR2 SET2 (lost plasmid pGal1TLC1) This study 4 and 5 YCC508, 509 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 BUR2 set2∆::URA3 (lost plasmid pGal1TLC1) This study 4 and 5 YCC510, 511 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 BUR2 SET2 + pGal1TLC1 This study 4 and 5 YCC512, 513 MATa-inc ade2-101 his3∆200 lys2-801 trp1∆63 ura3-52 leu2∆1:LEU2-GAL-HO VII-L::ADE2-TG(1-3)-HOsite-LYS2 rad52∆::hphMX4 BUR2 set2∆::URA3 + pGal1TLC1 This study 4 and 5 YCC562, 563 MATa/MATα his4-912δ/HIS4 his3∆1/HIS3 lys2-128δ/lys2∆0 ura3-52/ura3∆0 ade8/ADE8 suc2∆UAS(-1900/-390)/SUC2 bur1–1(ts)/BUR1 This study 6 YCC214, 215 JHUY761 TEL1/tel1∆::hphMX4 MEC1/mec1∆::kanMX SML1/sml1∆::TRP1 BUR2/bur2∆::LEU2 This study 7a YCC222, 223 JHUY761 MRE11/mrell∆::kanMX4 BUR2/bur2∆::LEU2 This study 7a YCC226, 227 JHUY761 KU80/ku80∆::kanMX4 BUR2/bur2∆::LEU2 This study 7a,b YCC228, 229 JHUY761 RIF1/rif1∆::kanMX4 BUR2/bur2∆::LEU2 This study 7a YCC230, 231 JHUY761 TLC1/tlc1∆::kanMX4 BUR2/bur2∆::LEU2 This study 7a YCC252 MATa/MATa his3∆1/his3∆1 leu2∆0/leu2∆ LYS2/lys2∆0 met15∆0/MET15 ura3∆0/ura3∆0 BUR1/bur1–8::kanMX4 TLC1/tlc1∆::LEU2 This study 8 BY4742 (YCC36) MATα his3∆1 leu2∆0 lys2∆0 ura3∆0 Brachmann et al., 1998 S1 YPH500 (YCC20) MATα ura3-52 lys2-801 ade2-101 his3∆200 trp1∆63 leu2∆1 Sikorski & Hieter, 1989 S1 W303 (OAy1003) MATα ade2–1 trp1–1 ura3–1 leu2–3,112 his3–11,15 can1–100 RAD5 Viggiani & Aparicio, 2006 S1 YCC205 MATa/MATα ura3∆0/ura3∆0 LYS2/lys2∆0 his3∆1/his3∆1 leu2∆0/leu2∆0 met15∆0/MET15 TLC1/tlc1∆::kanMX This study S2 JHUY895 MATa/MATα ura3∆0/ura3∆0 LYS2/lys2∆0 his3∆1/his3∆1 leu2∆0/leu2∆0 met15∆0/MET15 BUR1/bur1::kanMX This study S3 TABLE 2. Plasmids used in this study Plasmid name Brief description Source pRS316 Control plasmid for experiments Sikorski & Hieter, 1989 pBUR1 Contains BUR1 coding region in pRS316 (GP111, JHU1169) G. Prelich gift pRS426BUR1 Contains BUR1 coding region in pRS426 (JHU1171) This study pBUR1∆C Contains BUR1 1–365aa only in pRS316 (JHU1255) This study pBS4 (pH3:K36A) Plasmid in EMHy201 (HHT2:K36A HHF2/TRP/CEN/ARS/AmpR) Hyland et al., 2005 pESC-TRP-TLC1/HAT EST2 Overexpression plasmid containing TLC1 and EST2 (JHU1054) V. Zakian gift pGal1TLC1 Overexpression plasmid containing TLC1 derived from pesc-TRP-TLC1/HAT EST2 (JHU1238) This study SCR1/topo PCR2.1 Control plasmid for SCR1 expression (BCC41) This study ARN1/topo PCR2.1 Control plasmid for ARN1 expression (BCC43) This study pVL1091 (JHU995) Control plasmid for EST1 expression (Cdc13-Est1 fusion/pRS415) Evans & Lundblad, 1999 pVL369 (JHU612) Control plasmid for EST2 expression (2μ ADH-EST2 integrating) Lingner et al., 1997 pAY30 (JHU1166) Control plasmid for TLC1 expression (pRS316 TLC1) A. IJpma collection TABLE 3. Primers used in this study Primer ID 5′-3′ sequence Function Source OCC8 CGAATATTTAGAGAGAATCCGTCAC A primer for YLR226W BUR2 Winzeler et al., 1999 OCC16 TCAGTTATGGCTGTAGGTATTCCAT B primer for YLR226W BUR2 Winzeler et al., 1999 OCC162 TTTTGAATCATATTGAAACAAGGGT C primer for YLR226W BUR2 Winzeler et al., 1999 OCC163 TCGAAAATATTATTGATGCTTGTGA D primer for YLR226W BUR2 Winzeler et al., 1999 OCC164 CGTAGTATTTTCGTTTAAAATATATTACAGTAAGATAATGAGATTGTACTGAGAGTGCAC Upstream primer for KO of YLR226W BUR2 Winzeler et al., 1999 OCC165 CTGATCCCTCCAATTAAACATAACTTGTACTCTATTTTTACTGTGCGGTATTTCACACCG Downstream primer for KO of YLR266W BUR2 Winzeler et al., 1999 OCC166 GACCTAGGTCTCATTGTGACT A1 primer for YLR226W BUR2, 170 bp from ATG This study OCC167 AAGGTACTGTTGACTGCTAT D1 primer for YLR226W BUR2, 304 bp down from TAA This study OCC176 GGTAGCAACTCTGATATTCCACTGT A confirmation primer for YPR161C BUR1, 258 bp up from ATG Winzeler et al., 1999 OCC177 CTGTACACCCGTAAACTTTCTCACT B confirmation primer for YPR161C BUR1 Winzeler et al., 1999 OCC178 AGGAGTTAATAGATACGGACCCAAC C confirmation primer for YPR161C BUR1 Winzeler et al., 1999 OCC179 TTTTTGGCACTCTTTTAAATGGTAT D confirmation primer for YPR161C BUR1 Winzeler et al., 1999 OCC182 CAGATGCAGATCATTCTTCAGGAAT A1 confirmation primer for YPR161C BUR1 This study OCC183 TTGAACCAGTGACTTAGCTGGGAGT D1 confirmation primer for YPR161C BUR1 426 bp down from TAA This study OCC224 GAGAAGAAGCTGACTTCGACTATTG A confirmation primer for YJL168C SET2 Winzeler et al., 1999 OCC174 TTCAGTATTTCTTTTTCATCTTCCG B confirmation primer for YJL168C SET2 Winzeler et al., 1999 OCC175 GCTAAAGACATCGTGAAAATCCTAA C confirmation primer for YJL168C SET2 Winzeler et al., 1999 OCC225 AAAAATAAAGACACTTGAAACGCAC D confirmation primer for YJL168C SET2 Winzeler et al., 1999 OCC228 GTGGGATGGGATACGTTGAG SCR1(pol lll transcript) forward primer. Anneal to nt 20–39 (YM) This study OCC229 TTTACGACGGAGGAAAGACG SCR1(pol lll transcript) reverse primer. Anneals to nt 144–163 (YM) This study OCC230 ACCGATCCTCTTCTCGACCT TLC1 forward primer. Anneals to nt 417–436 (YM) This study OCC231 TAAACAGCGAACTCGTGCAA TLC1 reverse primer. Anneals to nt 516–535 (YM) This study OCC232 GAGATGAACAACAGCGCAAA EST1_F forward primer (SVC) This study OCC233 GAAACGCCATCTTTTTCTGG EST1_R reverse primer (SVC) This study OCC234 AAAACTGGCTGACGATTTCC EST2_F forward primer (SVC) This study OCC235 TTGGGAGCTTACGGCTAAAA EST2_R reverse primer (SVC) This study OCC236 ATCATTGGCGATGCTGACTT EST3_F forward primer (SVC) This study OCC237 CAAATATCGTGGCCTGGTTT EST3_R reverse primer (SVC) This study OCC238 AATGGAGGGCCAGAAAGACT ARN_F forward primer (SVC) This study OCC239 TCAAAAGGACACCAACGACA ARN_R reverse primer (SVC) This study OCC248 TGACGGGCGAATTATACAAC EST2_F new forward primer This study OCC249 ATTTTCCAAGCAGCGCCTTT EST2_R new reverse primer This study OCC274 atccttggtttaaagaggactagGTTATACTATTCTCTCTTCCTTTCTGGC GP111fwd Gibson deletion of BUR1 for BUR1∆C This study 0CC275 AGAGAGAATAGTATAACctagtcctctttaaaccaaggatggtgt GP111rev Gibson deletion of BUR1 for BUR1∆C This study 2.2 Telomere length screen in Saccharomyces non-essential gene deletion collection

To minimize the generation of suppressors in the haploid yeast deletion collection (Winzeler et al., 1999), we obtained a very early passage of the entire collection. To further minimize any growth advantage of revertants, strains were amplified by growing on yeast extract-peptone-dextrose plates (YPD) directly from the 96-well format plates. Six strains were propagated on one YPD plate in single strips. After overnight growth at 30°C, each strip of cells was scraped into water and genomic DNA was prepared from each mutant, cut with Xho1, and fractionated by 1% agarose electrophoresis as detailed in Kaizer et al. (2015) and Ritchie et al. (1999). Southern blot telomere length analysis was performed using a radiolabeled subtelomeric Y′ fragment and, in most cases, a radiolabeled 2-log ladder (NEB). Images were captured on XAR-5 film (Kodak) or Storage Phosphor screens (GE Healthcare). Bulk telomere lengths of the mutants were compared to those of wild type. The telomere lengths in the mutants were categorized based on a 5-point scale as either very short, short, wild type, long, or very long. Candidate genes were then re-tested by direct transformation to delete a given gene in a wild-type diploid, and tetrad analysis was performed to determine linkage. A germinated spore from a tetrad was propagated by one passage in liquid culture overnight for Southern blot analysis. Southern blots shown in this study contain, in most cases, numbers on the y-axis that indicate the sizes of the 2-log ladder in kilobases. The numbers on the x-axis describe the lane for samples analyzed on an agarose gel.

2.3 De novo telomere elongation assay

The de novo telomere elongation assay was performed as previously described (Diede & Gottschling, 1999). During the assay, cells were also collected for Southern, western, and qRT-PCR. For the bur1–8 experiments, the temperature was shifted when the cells were resuspended in galactose at T = 0 h.

2.4 Western blot analysis

Samples for western blot analysis were prepared and analyzed as described (Kaizer et al., 2015). Inactivation of H3 K36 trimethylation was monitored by immunoblot using the rabbit polyclonal antibody to histone H3 (trimethyl K36) at 1:2000 dilution (Abcam ab9050). A mouse monoclonal antibody to phosphoglycerate kinase (PGK1) at 1:10,000