Abstract

Introduction: Breast cancer remains a significant challenge due to disease recurrence and metastasis, often attributed to the persistence of treatment-resistant breast cancer stem cells (BCSCs). Citral, a compound derived from lemongrass essential oil, has demonstrated cytotoxic effects on various cancers, including breast cancer. This study investigates the anticancer mechanisms of Citral in BCSC-enriched 3D cultured spheroids and evaluates its therapeutic potential for estrogen receptor-positive breast cancer.

Methods: Using flow cytometry, the CD44+CD24- population was analyzed, and real-time PCR was employed to measure the expression of ALDH isoforms and pluripotency genes. Additionally, the Nanostring nCounter® PanCancer Pathway Panel was utilized to identify gene expression changes in cancer-related pathways.

Results: Citral treatment significantly reduced spheroid size and the CD44+CD24- stem-like cell population, accompanied by downregulation of ALDH isoforms and pluripotency genes. Gene expression analysis revealed Citral's modulation of key pathways, including PI3K/Akt signaling, cell cycle control, DNA damage response, and apoptosis.

Conclusion: These findings underscore Citral's potential as a promising anticancer agent, particularly for targeting estrogen receptor-positive breast cancer cells and BCSCs. Further preclinical and clinical studies are warranted to explore its therapeutic applications.

Introduction

Worldwide, cancer continues to be the leading cause of death, with almost 20 million new cases and 9.7 million cancer deaths in 20221. The Global Cancer Observatory 2022 (GLOBOCAN 2024) reported that female breast cancer was ranked second with 2.3 million new cases (11.6%), followed by other cancer types. These data indicate that breast cancer is responsible for one out of every four cancer cases and one out of every six cancer deaths1. Despite advancements in treating breast cancer, significant challenges remain, particularly when the disease is detected at advanced stages. Furthermore, disease recurrence and metastasis limit treatment options, leaving patients with an unfavorable prognosis and often resulting in succumbing to the disease. Recurrence is especially challenging in the treatment of estrogen receptor-positive breast cancer, as patients can remain at risk of developing secondary cancer many years after treatment2. The ultimate cause of breast cancer recurrence and metastasis remains unknown3; however, research has identified the presence of breast cancer stem cells (BCSCs) within tumors as the primary drivers4, 5. BCSCs are cells that can regenerate and differentiate, similar to normal stem cells, but are highly tumorigenic6. First identified by Al-Hajj et al.7, this unique cell population expresses surface markers, including CD44+CD24-, aldehyde dehydrogenase (ALDH), and epithelial-specific antigen (ESA) or CD326 (EpCAM)8, 9. The presence of BCSCs in breast cancer hinders treatment, as these cells are reported to be intrinsically resistant to chemotherapy and radiotherapy10, 11. Consequently, non-targeted cancer therapies can eliminate the proliferative and more differentiated cells that comprise the tumor mass. However, treatment-resistant BCSCs possess the capacity to regenerate the tumor gradually, which can lead to cancer relapse due to their self-renewal capability. Therefore, it is crucial to identify alternative approaches to cancer therapy that can directly target BCSCs to prevent cancer recurrence. The use of natural products for cancer prevention and treatment is gaining interest in drug discovery, particularly because they offer a rich source of novel therapeutic agents with minimal side effects12. Current therapy regimens primarily eliminate fast-growing cancer cells, leaving behind quiescent, drug-resistant BCSCs that can subsequently regrow tumors13. Thus, it is essential to identify potential drug candidates that can directly target BCSCs, thereby improving patient survival. Citral (3,7-dimethyl-2,6-octadienal), a naturally occurring essential oil derived from herbal plants such as lemongrass, has been reported to exhibit anticancer effects14, 15, 16. However, its effect on BCSCs remains unclear. Our previous studies have shown that citral can target drug-resistant breast cancer cells17, including its ability to inhibit the expression of the cancer stem cell marker ALDH1A318. Nevertheless, the mechanism behind these effects is still poorly understood, particularly in estrogen receptor-positive breast cancer cells. The organization of cells in a 3D manner provides better insight into the tumorigenesis mechanism of in vitro cancer models, although fully replicating the original tumor microenvironment remains a challenge. The 3D culture system also offers a promising link between traditional 2D cultures and animal models, making it a crucial tool for advancing research in tumor biology19. Therefore, this study explored the anticancer effect of citral on BCSCs and demonstrated that citral is a potent anticancer agent capable of reducing the size of generated breast cancer spheroids using a three-dimensional (3D) culture model. This model is believed to be an effective method for enriching BCSCs from breast cancer cell lines, making it a valuable tool for studying cancer stem cells. In the present work, we discovered that citral inhibits the expression of pluripotency genes and ALDH isoforms and reduces the number of CD44+CD24- stem-like cells. Citral’s mechanism of action on breast cancer spheroids was elucidated through the regulation of various pathways involved in breast cancer, including cell cycle, DNA damage, apoptosis, and stem cell pathways.

Methods Analysis of Citral by Gas Chromatography-Mass Spectrometry (GCMS)

To determine the purity and components of citral, also known as 3,7-dimethyl-2,6-octadienal (obtained from Sigma Aldrich; CAS 5392-40-5), a study was conducted using a Shimadzu GCMS QP2010 Ultra gas chromatography-mass spectrometry system from Shimadzu Corporation, Japan. The analysis utilized an Rxi™-5ms fused silica capillary column with polarity (30.0 m × 0.25 mm I.D. × 0.25 µm film thickness) from Restek Corporation, Bellefonte, PA, USA. The chromatographic conditions involved a temperature range from 50.0 °C to 300.0 °C (held for 10 minutes) at a rate of 3 °C/min. The sample injection took place at 250 °C using helium (99.9%) as the carrier gas at a flow rate of 0.8 mL/min, with an injection volume of 1 µL and a split ratio of 10:1. In terms of mass spectrometry operation, the ion source was set at a temperature of 200 °C; electron ionization was performed at 70 eV using a mode covering a mass scan range of m/z 40–700. Detection of the components in citral was based on comparing the obtained mass spectra with libraries such as NIST11.lib, NIST11s.lib, FFNSC1.3.lib, and WILEY229.LIB, along with cross-references to existing literature sources. Each component was tentatively quantified based on the relative peak areas in the chromatogram.

Cell Culture

The MCF7 breast cancer cell line (human estrogen receptor-positive), sourced from the human cell culture collection of the UPM-MAKNA Cancer Research Laboratory, Institute of Bioscience, Universiti Putra Malaysia, Malaysia, was used in this study. The cells were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) at 37 °C in a 5% CO2 incubator (Thermo Fisher Scientific, USA).

Generation of Breast Cancer Spheroids

A 0.6% agarose solution was used to coat cell culture vessels after solidification for 30 minutes at ambient temperature under sterile conditions. To generate breast cancer spheroids, breast cancer cells were cultured in the agarose-coated wells in serum-free DMEM/F-12 medium containing insulin (10 µg/mL), gentamycin (10 µg/mL), human fibroblast growth factor (hFGF) (0.1 µg/mL), hydrocortisone (1 µg/mL), antibiotic-antimycotic (50×), and B27 supplement (50×). Spheroids were grown for 5 days in a CO₂ incubator without disturbing the culture plates and analyzed using an inverted microscope.

CellTiter-Glo® 3D Assay

The cytotoxicity of citral on breast cancer spheroids was assayed using the Promega CellTiter-Glo® 3D reagent (Promega, USA). The CellTiter-Glo® 3D assay is an ATP-based assay that quantifies luminescent signals produced by the cells. This assay incorporates lytic activity to enhance penetration into cell aggregates such as spheroids, allowing full quantification of cell viability20. In each well of a 96-well plate coated with agarose, 3,000 cells were plated in 100 µL of spheroid growth medium. Breast cancer spheroids were formed by culturing the cells for 48 hours. These spheroids were then treated with concentrations of citral ranging from 0 µM to 500 µM for 72 hours. After treatment, CellTiter-Glo® 3D solution was added to lyse the spheroids by shaking them for 5 minutes in a microplate reader. The plate was incubated at room temperature for 25 minutes before measuring the luminescence signal using a microplate reader. IC₅₀ values for citral on breast cancer spheroids were determined by creating a dose-response curve using GraphPad Prism 7.0 software. The identified IC₅₀ was used for subsequent experiments, and the effects of citral treatment were compared to the untreated group. The IC₅₀ is commonly used to measure the drug concentration required to inhibit 50% of a biological process, helping researchers understand the drug's potency in pharmacological research21. The CellTiter-Glo® 3D experiments were conducted three times (n=3).

Effects of Breast Cancer Spheroids after Citral Treatment

Following the 72-hour citral treatment, breast cancer spheroids of MCF7 were observed under an inverted microscope. ZEISS ZenPro software was used to capture images of breast cancer spheroids that were both untreated and treated with citral. Subsequently, the size of the spheroids was measured using ImageJ software22. The size measurements obtained from both spheroids were recorded, and the results were analyzed by an unpaired t-test using GraphPad Prism 7.0 software.

Immunophenotyping of CD44+/CD24- Breast Cancer Stem Cells

Two surface markers, CD44+ and CD24-, were further assessed to identify the population of breast cancer stem cells (BCSCs). The staining steps for immunophenotyping of CD44+CD24- BCSCs were conducted by incubating the cell suspension with conjugated antibodies on ice and protected from light for 30 minutes. Following the manufacturer’s recommendations, the conjugated antibodies were diluted in FACS buffer to prepare antibody solutions. The cell suspension was stained concurrently with both antibodies for double staining (CD44-FITC/CD24-PE). Following incubation, the cells were collected by centrifugation at 1000 rpm for 5 minutes. After discarding the supernatant, the cells were washed once with ice-cold FACS buffer. To ensure a uniform, single-cell population, the cells were resuspended in 1 mL of FACS buffer and passed through a 40 µm cell strainer into FACS tubes. Stained cells were kept on ice and in the dark before being analyzed. A BD Fortessa® flow cytometer was utilized to assess the percentage of stained cells.

Table 1.

Quantitative Real-Time PCR (RT-qPCR) primers for ALDH isoforms and pluripotency genes

No Gene NCBI Gene ID Name* 5'---3' Sequence Length GC % Tm Size (bp) 1 ALDH1A1 NM_000689.5 f_ALDH1A1 TGGACCAGTGCAGCAAATCA 20 50 60.18 171 r_ALDH1A1 ACGCCATAGCAATTCACCCA 20 50 60.03 2 ALDH1A3 NM_000693.4 f_ALDH1A3 TGGCACGAATCCAAGAGTGG 20 55 60.32 101 r_ALDH1A3 TTGTCCACGTCGGGCTTATC 20 55 60.11 3 ALDH2 NM_000690.4 f_ALDH2 TTCTTCAACCAGGGCCAGTG 20 55 60.18 200 r_ALDH2 TTCCCCGTGTTGATGTAGCC 20 55 60.04 4