Animals and drug treatment

Male APPswe/PS1dE9 and C57BL/6 J littermates were purchased from the Shanghai Nanfang Research Center for Model Organisms (Shanghai, China). The genotypes were confirmed by PCR using tail tissue DNA. The mice were accommodated within a controlled environment that was free of specific pathogens, with an ambient temperature range of 20–25 °C and a light cycle of 12 h on and 12 h off. They had unrestricted access to food and water until they reached 8 months of age. Afterward, the mice were classified into four groups: C57BL/6 J littermate wild-type controls (WT), APPswe/PS1dE9 vehicle-treated controls (APP/PS1), APPswe/PS1dE9 treated with chemerin-9 at a dosage of 30 µg/kg body weight (APP/PS1 + C9-L), and APPswe/PS1dE9 treated with chemerin-9 at a dosage of 60 µg/kg body weight (APP/PS1 + C9-H). Chemerin-9 (C9, Item # 7117, Tocris Bioscience, Bristol, UK), a bioactive derivative of full-length chemerin consisting of C-terminal amino acids 148–156, was dissolved in sterile PBS. The dose selected for this study was based on our previous literature [19]. All groups of mice were treated intraperitoneally every other day for eight weeks consecutively. In accordance with the guidelines established by the National Institutes of Health (NIH) for the Care and Use of Laboratory Animals, all procedures were authorized by the ethical committee on animal welfare of Shanghai Sixth People’s Hospital Affiliated to Shanghai Jiao Tong University School of Medicine.

Y maze test

The working memory of mice was evaluated through spontaneous alternations at the Y-maze. The Y maze equipment consists of three equidistant arms placed at a 120-degree angle, measuring 15 cm in height, 30 cm in length, and 8 cm in width. The mice are introduced into the central region of the maze and permitted to navigate the apparatus freely for 5 min. The quantity of arm entries was captured on video and then automatically calculated by EthoVision XT software (Noldus). The concept of correct alternation was established to denote the sequential entry into three distinct arms. On the other hand, the notion of max alternation was introduced to signify the count of possible alternations, which is determined by subtracting 2 from the total number of arms entered. The percentage of alternation was computed by dividing the number of correct alterations by the max alternation.

Morris water maze test

The spatial learning and memory of mice were assessed using the Morris water maze (MWM) test, which was conducted with slight modifications in accordance with our previous methodology [19]. Briefly, the equipment utilized in the experiment comprised a round basin with a height of 50 cm and a diameter of 120 cm that was filled with tepid water at a temperature of 23 ± 2 °C. Additionally, a small circular platform with a diameter of 10 cm was positioned in the center of the objective quadrant, and it was submerged 1.0 cm below the water surface. During the orientation navigation test, conducted four times a day for five consecutive days, mice were granted 60 s to explore the submerged platform. Any mice unable to locate the platform within the allotted time frame were artificially guided to the platform and kept there for 10 s. The escape latency was measured as the time required to reach the platform during each trial. On the sixth day, a probe trial was performed during which mice were allowed to navigate freely for 60 s without the platform, and a video tracking system, EthoVision® XT 15, automatically assessed the number of times the mice crossed the platform, the time spent in the target quadrant, and the average swimming speed.

Nissl staining

Upon completion of behavioral experiments, the mice underwent transcardial perfusion with PBS, followed by 4% paraformaldehyde. The brains were subsequently embedded in paraffin and sliced into 5 µm thick sections for further staining. A deparaffinization process was subsequently performed on the brain sections, after which they were gradually rehydrated through the use of graded concentrations of ethanol. Finally, the brain sections underwent treatment with a conventional Nissl staining solution, and high-resolution images were obtained via optical microscope imaging.

Golgi staining

Golgi staining was performed to detect the morphology of the dendritic spines in the hippocampus. Following transcardial perfusion with PBS and 4% paraformaldehyde, the brains of mice were immediately taken and immersed in fixative for more than 48 h. The hippocampus was cut into 2–3 mm thick tissue and the tissue was gently rinsed several times with 0.9% NaCl solution and placed in a 45 ml round-bottomed EP tube. The tissue was then transferred to Golgi staining solution, and placed in a cool and ventilated place for 14 days. After finishing impregnation, the tissue was washed thrice with distilled water and immersed in 80% glacial acetic acid overnight. After the tissue became soft, it was washed with distilled water and immersed in 30% sucrose. Then the specimens were sectioned coronally at 100 μm by using a vibratome, mounted onto gelatin-coated slides, and kept in black wet boxes at 4 °C overnight. The slices were soaked with ammonia for 15 min, followed by washing with distilled water for 1 min. After soaking in Kodak Film Fix for 15 min, the slices were rinsed with distilled water for 3 min, and sealed with glycerol gelatin. The images were captured using a Nikon Eclipse E100 microscope. Dendritic spines were counted and statistically analyzed using ImageJ software. The spine density was measured and expressed as the number of spines per 10 μm dendrite.

Thioflavin-S

Thioflavin-S staining was performed as previously described [20]. Briefly, the brain sections underwent deparaffinization followed by hydration through a graded ethanol series. Subsequently, the sections were subjected to 1% Thioflavin S staining solution for 5 min and then differentiated in 70% ethanol for 1 min before being mounted. An Olympus microscope was used to capture images of all the sections.

RNA scope for in situ hybridization (ISH) combined with immunofluorescence staining

The brains of mice were promptly removed following transcardial perfusion with PBS, fixed in 4% paraformaldehyde, paraffin-embedded, and sliced into 5 μm thick sections. The RNAscope Fluorescent Multiplex Assay was utilized for in situ hybridization, wherein the sections underwent processing with the RNAscope® Fluorescent Multiplex Reagent Kit (Advanced Cell Diagnostics, Newark, CA) in accordance with the guidelines provided by the manufacturer. After being subjected to 4% paraformaldehyde fixation for 30 min at 4 °C, the sections were dehydrated in graded ethanol and subsequently treated with protease for 30 min at room temperature. Following this, the ChemR23 mRNA probe (Advanced Cell Diagnostics, Newark, CA) was employed for the hybridization process in the ACD HybEZ™ II oven at 40 °C for 2 h. The sections were then subjected to a sequential incubation process in the ACD HybEZ™ II oven, maintained at a temperature of 40 °C, utilizing amplification reagents. The amplification process was carried out in three stages, namely AMP-1 for 30 min, AMP-2 for 15 min, and AMP-3 for 30 min. Similarly, the process of immunofluorescence staining was carried out using identical steps to those employed in the immunofluorescence assay. Finally, the sections were observed under a fluorescence microscope.

RNA sequencing

To conduct RNA Sequencing (RNAseq) experiments, four hippocampus samples from each group were selected at random. Total RNAs were extracted by employing the Trizol reagent kit (Invitrogen, CA, USA) in accordance with the manufacturer’s guidelines. The quality of RNA was assessed using the Agilent 2100 Bioanalyzer and confirmed through RNase-free agarose gel electrophoresis. Subsequently, the mRNAs that had been enriched were fragmented into shorter fragments with the aid of a fragmentation buffer. These fragments were then transcribed into cDNA in a reverse manner, utilizing the NEBNext Ultra RNA Library Prep Kit for Illumina (NEB #7530, New England Biolabs, MA, USA). The cDNA library that was generated was sequenced by Gene Denovo Biotechnology Co. (Guangzhou, China) using Illumina Novaseq6000 technology. The reads obtained through sequencing machines underwent further filtration using fastp (version 0.18.0) to obtain high-quality clean reads. The differential expression analysis of RNA was conducted between two different groups through the use of DESeq2 software. Differentially expressed genes (DEGs) were identified by considering those with a false discovery rate (FDR) parameter below 0.05 and an absolute fold change of 2 or greater. A functional analysis was conducted on the DEGs of each group, which entailed enrichment of Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways and gene set enrichment analysis (GSEA).

Preparation of Aβ oligomers

To prepare Aβ oligomers, 1 mg of Aβ42 peptide (#010080051, HarO Life, Shanghai, China) was dissolved in 221.7 µl of cold HFIP (1,1,1,3,3,3-hexafluoro-2-propanol) to create a 1mM concentration solution. The solution was left at room temperature for an hour and then cooled on ice for 10 min. The resulting solution was divided into non-siliconized microcentrifuge tubes, with each containing 0.45 mg of Aβ42 in 100 µl solution, before being dried overnight at room temperature. The dried residues were then dissolved in 20 µl of dimethyl sulfoxide (DMSO) and mixed with F12 medium to create a 100 µM stock solution. The solution was left to incubate at 4 °C overnight, resulting in the formation of Aβ oligomers, which were further checked by western blot employing 6E10 antibody (Suppl. Figure 1).

Isolation and treatment of primary microglia

As was previously reported, primary microglial cells were collected from the pups on post-natal day 1 [21, 22]. Briefly, hippocampi and cortices from 1-day-old C57BL/6 J mice were isolated with the aid of a microscope and placed into ice-cold HBSS. After the meninges and leptomeningeal blood vessels were removed, the brain tissues were triturated and digested with 0.125% trypsin at 37 °C for 20 min. After neutralization and centrifugation at 1000 rpm for 5 min, the cells were plated in T75 flasks and cultivated in glial media consisting of DMEM supplemented with 10% fetal bovine serum and 100 µg/ml penicillin/streptomycin at 37 °C, 5% CO2 in order to generate mixed glial cultures. Every 4–5 days, half of the medium was changed and a confluent glial monolayer was established within 10–14 days. To harvest microglia, the flasks were placed in a 37 °C shaker for 15 min at 200 rpm. The media containing microglia was collected in a new tube and centrifuged at 1000 rpm for 5 min. After shaking, trypsin diluted 1:3 was added to the T75 flasks and incubated at 37 °C for 30 min with occasional shaking until the astrocyte layer was detached. Subsequently, the astrocyte layer was carefully removed and discarded. Microglia culture medium was then added to the flask, and the flask was shaken for 15 min to further obtain microglia beneath the astrocyte layer. Obtained microglia seeded in PDL-coated plates for the following experiment. Cell cultures were enriched for microglia by washing with DMEM for a minute, and then incubating a 1:3 dilution of trypsin in warm DMEM at 37 °C with 5% CO2 for 30 min with occasional shaking. The primary microglia were pretreated with or without the ChemR23 inhibitor α-NETA (10 µM) (31059-54-8, GlpBio, California, USA) for 2 h, followed by co-incubation with Aβ (5 µM) and chemerin-9 (500 nΜ) for 24 h.

For conditioned medium preparation, microglial cells were plated on 6-multiwell in microglial medium (DMEM + 10% FBS) at a density of 1 × 106 cells/well. The next day, microglial media was replaced with neuronal culture medium (neurobasal medium + GlutaMAX + B-27). After 24 h, conditioned medium (CM) was collected and centrifuged 1000 rpm for 5 min, then used for subsequent experiments or stored at − 80 °C.

Isolation and treatment of primary neuron

Primary hippocampal neurons were prepared from hippocampi and cortices of embryos at embryonic day 17 (E17). Briefly, brains were harvested and immersed in ice-cold HBSS, and the hippocampi and cortices were dissected after removing the meningeal and leptomeningeal vessels. Then, the hippocampi and cortices were minced and digested with 2 mg/ml papain (Macklin, Shanghai, China) and 0.1 mg/ml DNase (Macklin, Shanghai, China) at 37 °C for 30 min. After terminating digestion with FBS, the tissue was triturated gently with a 1 ml pipette to obtain a single-cell suspension which was plated onto glass coverslips coated with poly-L‐lysine at the density of 95 cells/mm2. After 3 h, the medium was replaced with neuronal culture medium containing neurobasal medium, GlutaMAX and B-27 (all from Gibco, California, USA). One-half of the culture medium was changed every 2–3 days and all experiments were performed at 5 days in vitro. The primary neurons were incubated for 24 h with CM harvested from differently treated primary microglia.

Aβ1−42 uptake assay

HiLyte Fluor™ 488-labeled Aβ1–42 peptide was prepared according to the instruction of the manufacturer (Anaspec, Fremont, USA). Briefly, the lyophilized Aβ42 peptide powder was dissolved in 1.0% NH4OH and immediately diluted with PBS to a concentration of 1 mg/ml. If not used immediately, the reconstituted peptide was stored at − 80 °C.

Primary microglial cells were plated on coverslips in a 24-well plate for 24 h. Then, the cells were pretreated with or without the ChemR23 inhibitor α-NETA (10 µM) for 2 h, followed by co-incubation with HiLyte Fluor™ 488-labeled Aβ1–42 (5 µM) and chemerin-9 (500 nΜ) for 24 h. After fixation with 4% PFA for 20 min and permeabilization with 0.1% Triton X-100 for 30 min at room temperature, cells were washed with PBS three times and blocked with 5% donkey serum for 1 h. Next, cells were incubated with primary anti-Iba1 antibody (1:250) at 4 °C overnight and then washed three times with PBST. Alexa 555-conjugated donkey anti-rabbit secondary antibody at a 1:1000 dilution was then applied for 1 h at room temperature. Nuclei were stained with DAPI for 5 min at room temperature. The cells were finally analysed using a confocal microscope (A1, NIKON, Tokyo, Japan).

qRT-PCR

The qRT-PCR was conducted in accordance with our previous description [19]. The RNAeasy™ animal RNA isolation kit with a spin column was employed to extract total RNAs from the hippocampus and primary microglia, following the manufacturer’s protocol. Utilizing the PrimeScript™ RT Master Mix (Perfect Real Time), isolated RNAs were subjected to reverse transcription to generate cDNA. The qPCR assay was carried out on the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, CA, USA), employing TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus). The amplification parameters utilized in this study involved an initial step of 95℃ for 30 s, followed by 40 cycles of 95℃ for 5 s and 60℃ for 34 s, 95℃ for 15 s, 60℃ for 60 s, and 95℃ for 15 s. The 2−ΔΔCt method was employed to determine the gene expression levels. The relative mRNA expression level in the WT or control group (target mRNA/β-actin value) was taken as the baseline of 100%, and the mRNA values in the APP/PS1 or Aβ-treated group were converted into fold changes after being compared with the WT or control group.

To detect transcriptions, the following PCR primer sequences were employed: β-actin, F: 5′-GTGACGTTGACATCCGTAAAGA‐3′, R: 5′‐GTAACAGTCCGCCTAGAAGCAC‐3′; ChemR23, F: 5′‐TACGACGCTTACAACGACTCC‐3′, R: 5′‐TAGGAGACCGAGGAAGCACA‐3′; chemerin, F: 5′‐GAGGAGTTCCACAAACACCCA‐3′, R: 5′‐ CTTCTCCCGTTTGGTTTGATTG‐3′.

Western blot analysis

The protein in the hippocampus and cultured primary microglia were analyzed via Western blotting, following the methodology we had previously described [19], albeit with minor modifications. To obtain a homogenized solution of the hippocampi and cultured primary microglia, RIPA buffer was utilized in conjunction with protease and phosphatase inhibitors and subjected to sonication. The concentration of protein was subsequently determined using the BCA kit (Beyotime, Nanjing, China). An equivalent quantity of protein was loaded onto sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for various samples, which were then transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking with 5% BSA in TBS-T, the membranes were subjected to overnight incubation at 4 °C with the primary antibodies listed below: synaptophysin (SYN) (A19122, 1:1000, Abclonal, Wuhan, China), postsynaptic density protein-95 (PSD95) (A6194, 1:1000, Abclonal, Wuhan, China), nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) (GB114320, 1:1000, Servicebio, Wuhan, China), apoptosis-associated speck-like protein containing a CARD (ASC) (10500-1-AP, 1:1000, Proteintech, IL, USA), caspase1 (A0964, 1:1000, Abclonal, Wuhan, China), APP (GB112075, 1:1000, Servicebio, Wuhan, China), Presenilin 1(PS1) (GB11779, 1:1000, Servicebio, Wuhan, China), PEN2 (A8678, 1:1000, Abclonal, Wuhan, China), BACE1 (A11533, 1:1000, Abclonal, Wuhan, China), Nicastrin (A0128, 1:1000, Abclonal, Wuhan, China), 6E10 (803001, 1:200, Biolegend, San Diego, USA), and β-actin (20536-1-AP, 1:1000, Proteintech, IL, USA). Following three washes with TBS-T, the membranes were treated with a secondary anti-rabbit antibody, namely horseradish peroxidase (HRP)-conjugated immunoglobulin G (IgG) (GB23303, 1:1000, Servicebio, Wuhan, China). The immunoblots were subsequently visualized using the enhanced chemiluminescence (ECL) kit (Invitrogen, CA, USA), with the grayscale value of signals being determined through quantification using ImageJ software.

Immunofluorescence staining

In vivo: The brains of mice were promptly removed following transcardial perfusion with PBS, fixed in 4% paraformaldehyde, paraffin-embedded, and sliced into 5 μm thick sections. A deparaffinization process was then performed on the brain sections, after which they were gradually hydrated through the use of graded concentrations of ethanol. Afterward, the brain sections were subjected to microwave heating to facilitate antigen retrieval. In vitro: The primary microglia were seeded onto glass coverslips in 6-well tissue culture dishes for 24 h, and primary microglia were pretreated with or without the ChemR23 inhibitor α-NETA (10 µM) for 2 h, followed by co-incubation with Aβ (5 µM) and chemerin-9 (500 nΜ) for 24 h. Afterward, the cells on glass coverslips were washed and fixed with cold 4% paraformaldehyde.

Subsequently, the brain sections or formaldehyde-fixed cells were treated with 5% BSA to block non-specific binding, followed by overnight incubation with nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) (GB114320, 1:1000, Servicebio, Wuhan, China), 6E10 (803001, 1:200, Biolegend, San Diego, USA), Clec7a (mabg-mdect, 1:100, InvivoGen, France), and Iba-1 (GB113502, 1:300, Servicebio, Wuhan, China) primary antibodies at 4 °C. The sections and the cells on glass coverslips were then washed thrice with PBS before being incubated with horseradish peroxidase (HRP)-conjugated immunoglobulin G (IgG) secondary antibody for 2 h at room temperature. After the final washes in PBS, DAPI was used to counterstain the nuclei. The sections were examined and analyzed using a fluorescence microscope (three slides per mouse for a corresponding region of interest).

Enzyme-linked immunosorbent assay

In accordance with the manufacturer’s instructions, enzyme-linked immunosorbent assay (ELISA) kits were utilized to quantify the levels of interleukin (IL)−1β, IL-6, TNF-α, Aβ1−40, and Aβ1−42 in the cortex and hippocampus and cultured primary microglia. In vivo: The brain samples were thawed on ice and homogenized in PBS using an electric tissue grinder. The tissue homogenates underwent centrifugation at 3000× g for 10 min at 4 °C, and the resulting homogenate supernatant was collected and the total protein concentration was determined by BCA Protein Assay Kit. Levels of IL-1β (#EK201B/3, Multisciences, Hangzhou, China), IL-6 (#EK206/3, Multisciences, Hangzhou, China), Aβ1−40, (#BPE11681, Langdun, Shanghai, China) and Aβ1−42 (#BPE11405, Langdun, Shanghai, China) were evaluated via commercial ELISA kits according to the manufacturer’s protocol. In vitro: The primary microglia were initially seeded in 6-well plates and incubated at 37 °C for 24 h. The cells were then subjected to pretreatment with the ChemR23 inhibitor α-NETA (10 µM) for 2 h before being co-incubated with Aβ (5 µM) and chemerin-9 (500 nΜ) for 24 h. Following collection, the culture medium was centrifuged at 12,000 rpm for 10 min, and then quantified the levels of IL-6 (#EK206/3, Multisciences, Hangzhou, China) and TNF-α (#EK282/4, Multisciences, Hangzhou, China) using mouse ELISA kits.

Calcein-AM and propidium iodide (PI) assays

Cells were stained with live-dead staining kits according to the manufacturer’s protocol (Yeasen Biotech, Shanghai, China). After the required treatment, the cells were incubated with the mixture of dyes (2 µl/ml Calcein-AM and 3 µl/ml PI) for 15 min at 37 °C. The results were analysed under a fluorescence microscope (IX53, Olympus, Tokyo, Japan). The red or green signals indicated the dead cells or viable cells, respectively.

Statistical analysis

GraphPad Prism 9 (GraphPad Software Inc., CA, USA) was utilized for statistical analysis. The data were expressed as mean ± standard error of the mean (SEM) and subjected to one-way analysis of variance (ANOVA) with Tukey’s post hoc test. For experiments with only two groups, the t-test was employed. In the case of the Morris water maze test’s hidden-platform training, the escape latency was analyzed by two-way repeated-measures ANOVA followed by Tukey’s post hoc test. Limma package was used to analyze the downloaded human transcriptomic datasets. The level of statistical significance was set at P < 0.05.