Chemicals and antibodies

Cells RIPA lysis and extraction buffer (89901) were purchased from Thermo Scientific (Waltham, MA, 02454). PMS (P9625) and MTS (G111) were obtained from Sigma-Aldrich and Promega Corporation (Madison, WI, USA), respectively. Modified Giemsa staining solution (C0131), Crystal violet staining solution (C0121), ECL luminescent solution (P0018S), EDU cell proliferation kit with Alexa Fluor594 (C0078S) and Eosin Staining Solution (C0109) were obtained from Beyotime (Shanghai, China). Cell Cycle Detection Kit (KGA512) was purchased from Key Gene (Netherlands). SC79 (HY-18749), API-2 (HY-15457), Shikonin (HY-N0822), and Tepp46 (HY-18657) were all purchased from MedChemexpress (NJ, USA). 2DG (PHR9231) and Chloroquine diphosphate salt (C6628, CQ) was obtained from Sigma (USA). The detailed information of antibodies was shown in Table S1.

Cell cultivations and transfections

The CRC cell lines including HT29, SW480, HCT116, HCT8, and LOVO were obtained from ATCC. All the cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (C11995500BT, GIBCO, NY, USA) complemented with 10% bovine serum (10099-141, GIBCO, NY, USA) and 1% antibiotics (UB89609, BIOODIN, China) at 37 °C,5% CO2. When the cells grew to 70%−80% confluency, transfections were performed. For the OE-SULT2B1 cell line construction, the OE-Ctrl and OE-SULT2B1 plasmids bought from Fenghui Biotechnology (China) were transfected by Attractive Transfection Reagent (301005, QIAGEN, Germany) according to the manufactory’ instructions, and the transfection was conducted in a 6 cm dish with 1000 ng plasmids. For SULT2B1 knockout cell line generation, the KO-SULT2B1 plasmids (1000 ng) (Genai Biotechnology) were transfected in a 6 cm dish by Attractive Transfection Reagent, and then monoclonal cells were screened and validated. The sequences of KO-SULT2B1 Crispr-cas9 gRNA were as follows (gRNA: GATGGGCACGGAGCGGATCCAGG). For interfering the AKT expression level, the siRNA (25 nM final concentration) (sc-43609, Santa, USA) were transfected by DharmaFECT Transfection Reagent (T-2002-02, Thermo Fisher Scientific, USA) according to the manufactory’ instructions. Moreover, theOE-PKM2 lentivirus (used at 100 MOI) was bought from OBiO (H5809, Shanghai, China), and infected indicated cells for 24 h.

Immunoblotting

The whole protein lysates were extracted from indicated cells, CRC patient’s tissues and mouse tissues with RIPA lysis and denatured at 100℃ for 15 min. Then the samples were separated by Pre-SDS-PAGE (Gel42012, E-life technology Beijing), transferred to PVDF membranes (88520, Invitrogen, USA), and blocked with 5% skim milk powder. Whereafter, the membranes were incubated with the specific primary antibody at 4℃ overnight, the secondary antibody for 1 h at room temperature, and the bands were visualized by means of the ECL luminescent solution.

The surgical specimens of CRC patients were collected from the department of general surgery at the Second Hospital of Lanzhou University, and the detailed information of CRC surgical patients was listed in Table S2.

Real-time quantity PCR

The total cellular RNA was extracted using the RNA Easy Fast Tissue/Cell Kit (DP451, TIANGEN, Beijing, China) according to the manufacturer’s protocol. 1 ug of RNA was conducted as reverse transcription incubated at 37 ℃ for 15 min using 5 × EasyQuickMasterMix (CW2634M, CWBIO, China). The reactions were terminated by heat inactivation at 85 °C for 5 s. Subsequently, qPCR was initiated with a degeneration for 10 min and then went into the cycle program with 95 °C (15 s), 60 °C (45 s), and 72 °C (1 min) for up to 40 cycles. The sequences of primers for amplification were as follows:

Gene

Primer

Nucleotides

SULT2B1

Forward (5′ → 3′) Reverse (5′ → 3′)

CGGGCTTGTGGGACACCTA CATCTTGGGTGTTCTCCGCC

β-Actin

Forward (5′ → 3′) Reverse (5′ → 3′)

GCCTGACGGCCAGGTCATCAC CGGATGTCCACGTCACACTTC

Cell viability assay

The specific cells were divided into 96-well plates (5000–10,000 cells per well) and cultured overnight with or without specific treatments. Whereafter, the detection mix containing MTS/PMS (20:1) was added with 10 µL per well, and continuously cultured for 1–2 h. Cell viability were detected at 492 nm absorbance by a microplate reader.

Colony growth assay and EDU-staining cell proliferation assay

For colony growth assay, the cells were separated into 12-well plates, ensuring 100–200 cells per well, and continually cultured for approximately 14 days. After that, the cell colonies were fixed with paraformaldehyde at room temperature for 15 min, stained with Giemsa dye, and then pictures were taken, followed by counting the number of colonies by means of Image J software.

For EDU-staining cell proliferation assay, the cells were separated into a 24-well plate and cultured continuously overnight. Subsequently, EDU staining was performed as the manufacturer’s introduction. Finally, the photographs were taken under a fluorescence microscope, and the data was analyzed using Photoshop and Image J software.

Would healing test and transwell invasion assay

For a wound healing test, the cells with 70–80% confluence were collected, suspended, and divided into scratch plugs in a 12-well plate, with 110 µL per small compartment. After growing for an entire night, the plugins were vertically removed, and floating cells were washed away with PBS. Following this, low serum medium (1% FBS, 1% antibiotics) was added to each well. Then the cells were cultured continuously with or without specific treatment. At indicated time, a microscope was used to photograph the scratch statuses and measure the closed wound areas with Photoshop software.

For Transwell invasion assay, in brief, the cells suspended by the low serum glucose-free DMEM medium (1%) were separated into the up chamber with Matrigel following the 10% serum high glucose DMEM medium was added to the lower chamber. After a 24–48 h continuous culture, the cells were fixed, washed, and stained. Whereafter, the images were taken under a microscope, and then counted by Image J software.

Immunohistochemistry (IHC) staining

The human tissue microarray (D100Co01) was purchased from Ernan Biotechnological Company (Xi’an, China). For xenograft tumors, the samples were fixed, dehydrated, embedded in paraffin, and then sectioned into sections with a thickness of 4 μm. Subsequently, the microarray and sections were baked, dewaxed, hydrated and repaired antigen. Thereafter, the Rabbit/mouse IgG-two-step immunohistochemistry kit (SV0004, BOSTER) was used following the instructions (primary antibody: diluted at 1:100). After DAB (AR1027-3, BOSTER) color developing, hematoxylin staining, dehydrating and sealing sheet, scanning was performed by 3D HISTECH.

The IHC results were scored by the product between the percentage of positive cells (1, 2, 3 and 4 represent 0–25%, 26–50%, 51–75%, 76–100%, respectively) and the intensity (1, 2 and 3 represent low, moderate, high, respectively).

Co-immunoprecipitation assay

The cells were lysed by IP lysis buffer (P0013, Beyotime), and the specific primary antibodies were added into the lysates for incubation at 4 ℃ overnight. After that, the proteins were precipitated by Protein A/G magnetic beads (MCE: HY-K0202; NJ, USA) via a hopper magnet. Then the proteins were separated with heating, and then the samples were subjected to immunoblotting analysis.

GST pull-down assay

The purified proteins of His-SULT2B1 (HY-P74420) as well as His-AKT-GST (HY-P76666) were purchased from MCE (NJ, USA), and they were dissolved by water. Whereafter, 10 ug of the purified proteins were incubated at 4 ℃ for 4–6 h, and the GST magnetic agarose beads (P2258, Beyotime), with a magnetic stand, were added to precipitate the proteins. With a heat at 100 ℃ for 10 min, the proteins were separated from the beads, and then the samples were electrophoresed in SDS-PAGE, and subjected to immunoblotting analysis.

Immunofluorescence and fluorescence microscopy

Cells were plated on cover slips, and the indicated treatments were then conducted. Cells were fixed with freshly prepared 4% paraformaldehyde at room temperature for 15 min following washed with phosphate-buffered saline (PBS). Then cells were permeabilized with PBS containing 0.1% Triton X-100 and 0.5% BSA at room temperature for 10 min. Subsequently, cells were incubated with the indicated primary antibodies at 4 °C overnight. After washing three times, cells were incubated with the secondary antibodies for 1 h at room temperature. The nuclei were stained by VECTASHIELD with DAPI (H1200) after washing three times. Images were acquired by fluorescence microscopy (Nikon). For mCherry-GFP-LC3B adenovirus (AD202001, Vigene Biosciences, Shandong, China) transfection cells, cells were fixed with freshly prepared 4% paraformaldehyde, and then washed three times with PBS. VECTASHIELD with DAPI (H1200) was added to the cells to visualize nuclei, and images were acquired by fluorescence microscopy (Nikon).

Chromatin immunoprecipitation (ChIP) assays

BeyoChIP™ ChIP Assay Kit (Protein A/G Magnetic Bead) (P2080S, Beyotime) was employed to conduct the ChIP assay, and the experiment followed the manufacturer's instructions. In brief, 4 × 106 cells were crosslinked with 1% formaldehyde for 10 min at 37 ℃, and then the reaction was stopped by glycine. Cells were collected, and cell nucleuses were prepared and treated with Micrococcal Nuclease (D7201S, Beyotime) to obtain 400–800 bp DNA fragments. Whereafter, chromatin immunoprecipitation was performed with the indicated primary antibody as well as Protein A/G Magnetic Beads, and then the crosslinked DNA was separated at 65℃ for 2 h and purified with DNA Clean-up Kit (CW2301S, CWBIO, China). ChIP samples were subjected to PCR and agarose gel electrophoresis to perform quantitative analysis. The sequences of primers for amplification were as follows:

Gene

Primer

Nucleotides

PKM2

Forward (5′ → 3′) Reverse (5′ → 3′)

TGCAGGATTCCAGACCCTACT

GGCCGTTTTCCTCTTAGGACC

Xenograft of CRC cells in nude mice models

The Ethics Committee of Lanzhou University has approved the experiment. All the mice were purchased from Beijing HFK Bioscience Co., LTD. (Beijing, China) and maintained in the Jining Medicine University facility under specific-pathogen-free (SPF) conditions. The mice were divided into groups randomly. The indicated cells with or without the specific agents were injected into the abdominal subcutaneous tissues of mice with 0.1 mL (1 × 107 cells/mL) to construct xenografts of CRC cells in nude mice.

Xenografts of CRC cells in nude mice were constructed firstly, and then the API-2 (1 mg/kg) as well as Shikonin (1 mg/kg) was intraperitoneally injected three times per 3 days, respectively. The tumors were gained after 20 days of inoculation. Simultaneously, the tumor volumes as well as weights were measured and recorded. Subsequently, the indicated molecules were examined by HE and IHC staining.

Statistical analysis

The data was shown as mean ± S.D. The two-sided Student’ s t test was utilized to analyze the statistical significance between two groups’ comparison, and the one-way ANOVA was used among multiple groups’ comparisons. P < 0.05 was regarded as statistical significance. Most of the data was gained from three independent experiments.