Bioinformatic analysis

The Tumor Immune Estimation Resource (TIMER) database (https://cistrome.shinyapps.io/timer/) was used to demonstrate the differential expression of SLC38A5 in different tumor tissues and the corresponding normal tissues. We downloaded osteosarcoma cases from the TARGET database (https://portal.gdc.cancer.gov/) and the GEO database (https://www.ncbi.nlm.nih.gov/geo/). We excluded patients who lacked follow-up information or had unknown survival status, ultimately including a total of 139 cases in the survival analysis, consisting of 86 cases from the TARGET database and 53 cases from the GSE21257 dataset.

Clinical samples

The 12 groups of human osteosarcoma tissues and the corresponding adjacent normal tissues used in this study were obtained from patients with a histopathological diagnosis of osteosarcoma undergoing surgery at Renmin Hospital of Wuhan University. All patients signed informed consent, and the collection and use of human samples were approved by the Ethics Committee of the Renmin Hospital of Wuhan University. The ethics submission and approval is in accordance with the Helsinki Declaration.

Cell culture and transfection

The human osteosarcoma cell lines HOS, Saos-2 and MG63 were purchased from Wuhan Servicebio Technology Co., Ltd. The human osteoblast cell line hFOB1.19 and osteosarcoma cell lines 143B and U2OS were obtained from the National Collection of Authenticated Cell Cultures (Shanghai, China). Cells were cultured in RPMI-1640 medium (#PM150110, Procell, Wuhan, China) supplemented with 10% FBS (#A5670701, Gibco, USA) and 1% penicillin/streptomycin (#G4003, Servicebio, Wuhan, China) and were propagated with 5% CO2 at 37 °C. For transfection, we constructed SLC38A5 overexpression (LV-SLC38A5), SLC38A5 knockdown (shSLC38A5), and the control (LV-Control and shNC) using the lentivirus obtained from OBiO (Shanghai, China). The PI3K inhibitor (BKM120) was purchased from MedChemExpress (USA). The siRNAs of SREBP1 and SCD-1 were obtained from OBiO (Shanghai, China). The primers sequences were:

siSREBP1-1: CCCTGTGCTGACGGAAGCCAA; siSREBP1-2: GCCATCGACTACATTCGCTTT; siSCD-1-1: CCTACGACAAGAACATTCAAT; siSCD-1-2: AGTTTCTAAGGCTACTGTCTT.

RNA sequencing and qRT-PCR

Cells stably transfected with shSLC38A5 and shNC were collected for RNA isolation. The TRIzol® Reagent (Invitrogen, USA) was used to extract total RNA from the shNC and shSLC38A5 143B cells, following the manufacturer’s protocol. RNA concentration and purity was measured using NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE). RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). Then, the RNA was sent to the BGI (Shenzhen, China) for RNA-seq analysis. Sequencing libraries were generated using Hieff NGS Ultima Dual-mode mRNA Library Prep Kit for Illumina (Yeasen Biotechnology (Shanghai) Co., Ltd.) following manufacturer’s recommendations and index codes were added to attribute sequences to each sample. Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Subsequently, 2 × 50 bp pair-end RNA sequencing was performed on the BGISEQ-500 platform according to the manufacturer’s protocol. For subsequent investigation, RNA-seq data in the FPKM format were used. Differential expression analysis of two conditions/groups was performed using the DESeq2. Genes with an adjusted P-value < 0.01 & | log2(fold change) | >1 found by DESeq2 were assigned as differentially expressed. The qRT-PCR was performed using SYBR® Premix Ex Taq™ (TaKaRa, Tokyo, Japan). The primers sequences were: SLC38A5, forward,5’-AACCTGAGTCTGAGTTGCGG-3’and reverse,5’-AGGGAGGGCTCCATTCATCT-3’; GAPDH, forward,5’-TGCAACCGGGAAGGAAATGA-3’and reverse,5’-GCATCACCCGGAGGAGAAAT-3’. The mRNA expression of GAPDH was used as an internal control.

Western blot

Cell lysates were prepared in RIPA buffer (#G2002, Servicebio, Wuhan, China) with protease and phosphatase inhibitors. After quantification of protein concentration using a BCA kit (#G2026, Servicebio, Wuhan, China), proteins (10 µg) were separated by SDS-PAGE and transferred onto PVDF membranes. Then, membranes were blocked in TBST buffer containing 5% non-fat milk for 2 h and incubated with primary antibodies overnight at 4 °C. After washing with TBST, the secondary antibody was incubated at room temperature and the membrane was detected with ECL reagent (#BL520B, Biosharp, China). The antibodies against SLC38A5 (1:1000, #ab72717), GPX4 (1:3000, #ab125066), Nrf2 (1:2000, #ab137550), SREBP1 (1:1000, #ab313881), SCD-1 (1:10000, #ab39969) were purchased from Abcam (Cambridge, UK). Antibodies targeting GAPDH (1:100000, #A19056), E-cadherin (1:1000, #A3044), N-cadherin (1:1000, #A3045), Vimentin (1:50000, #A19607), p-PI3K (1:3000, #A22730), PI3K (1:10000, #A0265), AKT (1:1000, #A18120), p-AKT (1:1000, #AP1208), p-mTOR (1:1000, #AP0978), mTOR (1:2000, #A2445) were obtained from Abclonal (Wuhan, China).

CCK-8 and colony formation assay

The assay of cell proliferation ability in this study was performed by CCK-8 and colony formation assays. Briefly, 4 × 103 cells in 100 µl culture were added into each well of a 96-well plate and daily measurements performed from day 1 to 5. At each time point, 10 µl of CCK-8 reagent (#C0037, Beyotime, China) was added to each well. The OD450 (optical density) was detected with a microplate reader. For colony formation assay, 5 × 102 cells were added into each well of a 6-well plate and incubated for 2 weeks. After washed and fixed, the colonies were stained with 0.1% crystal violet, then, photographed and counted.

Cell migration and invasion assay

The wound healing assay was used to test cell migration ability. Cells were seeded in 6-well plates, and when the cell density was about 90%, a wound was made in the center of the well using a 100 µl pipette tip. Subsequently, the cells were cultured in serum-free medium for 36 h. The wound was observed using an inverted microscope (Olympus, Japan) and measured by ImageJ.

Transwell invasion assay was conducted using transwell chambers and Matrigel (Corning, USA)0.1 × 105 cells in 200 µl serum-free medium were added into the upper chamber precoated with Matrigel, and 600 µl medium containing 20% FBS was added into the lower chamber. After incubation for 48 h, invaded cells were stained with 0.1% crystal violet and observed by an inverted microscopy.

Immunohistochemistry (IHC)

Tumor xenografts were fixed (4% Paraformaldehyde for 12 h), paraffin-embedded, and sectioned according to the standard protocol. The sections were deparaffinized with xylene, hydrated with alcohol. Antigen retrieval was performed using Tris-EDTA antigen retrieval solution (Servicebio, Wuhan, China) through the heat-induced antigen retrieval method. Subsequently, endogenous peroxidase was inactivated, and the sections were blocked with BSA. Subsequently, the sections were incubated with primary antibodies, SLC38A5 (1:200, #ab72717, Abcam), p-mTOR (1:100, #ab109268, Abcam), GPX4 (1:100, #ab125066, Abcam), N-cadherin (1:150, #A3045, Abclonal). Then the sections were cleaned and incubated with secondary antibodies. The chromogenic detection was performed using a DAB kit (CST, USA). The sections were examined and imaged with a brightfield microscope (Olympus, Japan).

Glutamine and Malondialdehyde measurement

According to the manufacturer’s protocol, glutamine, glutathione and MDA levels were determined by the glutamine assay kit (#MAK438, Merck, Germany), the GSH assay kit and the lipid oxidation (MDA) assay kit (#S0131S, Beyotime, China). Glutamine was purchased from the Servicebio (Wuhan, China).

OCR and ECAR measurement

Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were conducted following the manufacturer’s protocol (Seahorse XFe24 Analyzer, Agilent). Briefly, cells were seeded onto XF-24 plates at a density of 5 × 105 cells/well for 24 h Then, they were incubated in XF assay media for 1 h at 37 °C in a non-CO2 incubator and stressed with sequential addition of 1µM oligomycin, 2µM carbonyl cyanide p-(trifluoromethoxy) phenylhydrazone, and a 0.5µM cocktail of rotenone/antimycin A.

Animal models

Four-week-old male athymic mice were purchased from the Shulaibao Biotechnology (Wuhan, China), and reared in the Animal Center of Renmin Hospital of Wuhan University. All animal experiments were performed following the protocol approved by the Animal Care and Use Committee of Renmin Hospital of Wuhan University. The mice were randomly divided into two groups and subcutaneously injected with shSLC38A5 and shNC 143B cells. The mice were observed every two days for changes in diet, spirit, activity status and weight, and were assessed for pain and distress. Tumor volume was measured every 5 days, and the tumor volume was calculated as V = L×W2/2, where L and W are the longest and shortest diameters (mm). Four weeks after injection, all mice were sacrificed, and the tumors were collected for further analysis.

Statistical analysis

GraphPad Prism 8.0 and SPSS 15.0 were used for statistical analysis. All results are presented as mean ± standard deviation (SD), and differences between the groups were analyzed by Student’s t-test and one-way ANOVA. P < 0.05 was considered statistically significant.