Cell lines

The normal human bronchial epithelial cell line BEAS-2B, the human NSCLC cell lines A549, H1299, HCC827, PC9 and H1975; the mouse Lewis lung cancer (LLC) cell line were purchased from the Chinese Academy of Sciences Cell Bank (Shanghai, China) and preserved by our laboratory. The HEK293T cell line was preserved by our laboratory. All the cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% FBS (Invitrogen, USA) and 1% penicillin/streptomycin at 37 °C with 5% CO2.

Plasmid construction, cell transfection, and treatment

circMBOAT2 overexpression and shRNA plasmids along with the corresponding control lentivirus were designed and synthesized by Hanbio Biotechnology (Shanghai, China). A sketch structure of circMBOAT2 overexpression and empty vector plasmid construction was shown (Fig. S1A). Briefly, for circMBOAT2 overexpression version, circMBOAT2 was amplified from cDNAs reverse-transcribed from 293 T cells, and PCR product was cloned into the pHBLV-CMV-circ-EF1-ZsGreen-T2A-Puro vector, for circMBOAT2 interference version, pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO was utilized (Fig. S1B). The transfection of shRNAs and plasmids were performed using the LipofiterTM kit (Hanbio Biotechnology, Shanghai, China) according to the manufacturer’s instructions. Ctcf silencing plasmids were obtained from the Public Protein/ Plasmid Library (Nanjing, China). After 72 h lentivirus packaging, the virus-containing supernatant was collected. Subsequent infection of A549 and H1299 cells with the lentiviruses, aiming to achieve overexpressing or silencing of circMBOAT2. Additionally, LLC cells were transfected with scrambled (control) shRNA or Ctcf shRNA. Stable overexpression and knockdown cell lines were established by subjecting the infected cells to selection using 2 μg/mL puromycin (Hanbio Biotechnology). The specific small interfering RNAs (siRNAs) targeting CTCF and negative control (NC) were procured from Hanbio (Shanghai, China). Transfection of cells with either si-CTCF or NC plasmids was carried out using Lipofectamine 3000 (Invitrogen, Carlsbad, CA), adhering to the manufacturer’s instructions. Details of the shRNA, siRNA, and overexpression sequences used are listed in Supplementary Table S1.

To investigate the effects of norepinephrine (NE) treatment, both transfected and untransfected A549 and H1299 cells were subjected to varying durations of NE exposure, and subsequent experiments were performed on these cells.

RNA extraction, genomic DNA (gDNA) extraction, and quantitative real-time PCR (qRT–PCR)

Total RNA was extracted from cells and tumor tissues with TRIzol reagent (Invitrogen, Carlsbad, CA). The RNA was then reverse transcribed to cDNA using the PrimeScript™ RT reagent Kit (TAKARA, Japan). qRT‒PCR analysis was performed with a TB Green Premix Ex Taq™ II kit (Takara, Japan). GAPDH (Sangon, Shanghai) was used as an internal control. Relative RNA expression was calculated using the 2-ΔΔCt method. The primers used for MMU_CIRCpedia_14285 and U1 were obtained from RiboBio. The other sequences of primers employed can be found in Supplementary Table S2.

Sanger sequence analyses

RNA was extracted from A549 and H1299 cells and then reverse transcribed into cDNA. The PCR products were subjected to Sanger sequencing by Sangon Biotech Company (Shanghai, China).

Nucleic acid electrophoresis

Genomic DNA (gDNA) was extracted from A549 and H1299 cells according to the TIANamp Genomic DNA Kit protocol (Tiangen, Beijing). cDNA was synthesized as above. Quantitative PCR assay was performed on ABI StepOne (Carlsbad, CA, USA). The divergent, convergent (both obtained from RiboBio, China), and GAPDH primers were amplified in both cDNA and gDNA. The products were analyzed via 1% agarose gel electrophoresis with 0.01% GelRed. DNA was separated by electrophoresis at 100 V for 50 min. The bands were visualized by UV irradiation.

RNase R treatment and Actinomycin D assay

To determine the stability of circMBOAT2, RNase R and Actinomycin D assays were executed. A549 and H1299 cells were subjected to either RNase R treatment(3 U/μg, Epicenter, Madison, USA) at 37 °C for 30 min after extracting total RNA or Actinomycin D treatment (2 μg/ml) for various durations (0, 4, 8, 12, 16 or 24 h) before RNA was isolated. The relative expression levels of circMBOAT2 and MBOAT2 were measured using qRT-PCR.

Isolation of nuclear and cytoplasmic fractions

A549 and H1299 cells were harvested for nuclear and cytoplasmic isolation using a Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biote, Canada), and the RNA levels of circMBOAT2, MBOAT2, GAPDH, and U1 in the nuclear and cytoplasmic fractions were tested via qRT‒PCR.

Fluorescence in situ hybridization (FISH)

The subcellular localization of circMBOAT2 was tested by FISH. The Cy3-labeled circMBOAT2 (5′ AAGTTGACCATCATGAATTTCGCAA 3′) probe was synthesized by GenePharma (Shanghai, China). A549 and H1299 cells were fixed in 4% formaldehyde and hybridized at 37 °C overnight. Then, the cells were dyed with DAPI working solution. Finally, the cells were imaged using a fluorescence microscope.

CCK-8 assay

A549 and H1299 cells (3000 per well) were seeded into 96-well plates. Ten microliters of Cell Counting Kit-8 (CCK-8) solution (NCM Biotech, Suzhou, China) was added to each well after the cells were incubated at 37 °C for 24–120 h. The optical density (OD) was then measured at 450 nm.

Colony formation assay

Fifty to one hundred A549 and H1299 cells were seeded into 6-well plates and cultured for approximately 10–14 days. Then, the colonies were fixed with methanol and stained with 0.1% crystal violet (Sangon, China) for 15 min. The colony formation rate was calculated by counting the number of stained colonies.

Transwell migration and Matrigel invasion assays

A total of 100 μl of serum-free medium containing A549 or H1299 cells (5 × 104 cells/mL in knockdown cells and 3 × 104 cells/mL in overexpressed cells) was added to the upper chamber in the presence (for the invasion assays) or absence of (for the migration assays) Matrigel (BD Biosciences), 600 μl of medium containing 10% FBS was added to the lower chamber. After the Transwells were incubated at 37 °C for 24 h, the invaded or migrated cells were fixed, stained with 0.1% crystal violet and counted under a microscope (Olympus, Tokyo, Japan).

Scratch healing assay

A549 and H1299 cells (2 × 105/mL) were grown to 100% confluence in six-well plates for 24 h. Then, the cells were wounded with a 10 μl pipette tip. Images of the wounds were recorded at 0 h and 24 h using a microscope. The percentage of wound closure was calculated by ImageJ (version 1.8.0; National Institute of Health, Bethesda, MD, USA) software.

Animal experiments

Mice: Female C57BL/6 mice aged 6–8 weeks were purchased from Shanghai JSJ Laboratory Animal Co., Ltd. (Animal Quality Certificate: 20180004050501) and maintained in a SPF-grade laboratory for one week to adapt to the environment. None of the animals were excluded from the study except for mice with significant behavioral deviations. Exclusion rules: Locomotion Index< 80 or/and >300; Exploration Index>40). The sample size for each experiment was estimated based on previously reported preclinical studies [19].

CUMS mouse model: Mice were subjected to CUMS, as previously described [20] for 8 weeks to establish the CUMS model, as shown in the flow chart of the experimental design (Fig. S2).

Subcutaneous heterotopic transplantation LLC model: Mice were subcutaneously injected with 1 × 107/mL LLC-NC or LLC-shCtcf cells in 100 µl of PBS to establish a subcutaneous heterotopic transplantation tumor model. Tumor volume was measured every three days.

Injection of ASOs: Three ASOs targeting MMU-CIRC-pedia-14285 (circMBOAT2) were designed and synthesized by RiboBio and subsequently transfected into LLC cells. The silencing efficiency of ASO-2 (sequence: AGGATGAAGAACTGACTCCG) was most notable in LLC cells according to qRT‒PCR (Fig. S1C). Thus, after modification, 10 µM ASO-2 was injected intratumorally into the tumor three times per week for three weeks.

All the animal experimental protocols were approved by the Institutional Ethics Committee of Shanghai University of Medicine & Health Sciences Affiliated Sixth People’s Hospital South Campus (No. 2022–0340). All mice were randomly assigned during treatments and were euthanized at the indicated time points, heterotopic transplantation tumors (no longer than 1.5 cm) were photographed, weighed, and fixed with 4% paraformaldehyde solution/or snap-frozen. Blinding was performed during data analysis.

Behavioral tests [21].

As described before [17], The open-field test (OFT) was performed to evaluate locomotor and exploratory behavioral differences before and after CUMS in a quiet room using a ZS-ZFT Video Analysis System (ZSDC Science and Technology Co., Ltd., Beijing, China). The Locomotion Index measures the overall movement of a mouse within a given area. It is calculated by tracking the number of entries into a given area over a specific period (5 min). The Exploration Index assesses the animal’s tendency to explore new environments. It is often measured by recording the number of times mice engage upward in an open field. These two indexes together estimate the horizontal exploration ability and vertical exploration ability of mice. The sucrose preference test (SPT) was also used to observe depression-like behavior.

Microarray analysis for circRNA

Total RNA of tumor tissues in the tumor group and the tumor+CUMS group (three in each group) was extracted as above-mentioned. The Agilent Mouse lncRNA Microarray 2019(4*180k, Design ID:086242) was used for microarray analysis and data analysis of the 6 RNA samples were conducted by OE Biotechnology Co., Ltd. (Shanghai, China).

Hematoxylin and eosin (H&E) staining

The tumor tissues were cut into thin sections with a thickness of 5 μm. These sections were then subjected to staining using H&E procedures.

RNA immunoprecipitation (RIP)

The RIP assay was performed using a MagnaRIP RNA-Binding Protein Immunoprecipitation Kit (Millipore, MA, USA). Briefly, A549 and H1299 cells were harvested and lysed in RIP lysis buffer, and then incubated with magnetic beads coated with 5 μg of IgG (negative control) or antibody against CTCF (Santa Cruz. TX, USA) with rotation at 4 °C overnight. The immunoprecipitated RNAs were extracted and detected by qRT-PCR. A total of 10% of inputs were used for qRT-PCR.

Immunohistochemistry (IHC)

Tumor tissues of mice were fixed in 10% (v/v) formaldehyde in PBS, embedded in paraffin, and cut into 4 μm sections and used for IHC staining with antibody against Ki67 (1:1000, Abcam, England). The representative images were acquired under a light microscope (Olympus IX73, Tokyo, Japan). The positive degree was calculated as the number of immunopositive cells × 100% divided by the total number of cells/field into 10 random fields at ×400 magnification.

Western Blotting

Western Blotting was performed following the standard protocol. In brief, after separated with SDS-PAGE gel, total cellular proteins were transferred to a Nitrocellulose membrane (Millipore, USA). The Nitrocellulose membrane was then incubated with CTCF antibody (Santa Cruz Biotechnology, TX, USA) overnight at 4 °C. The enhanced chemiluminescence (ECL) substrate (NCM Biotech, Suzhou, China) was used to visualize target protein.

Statistical analysis

All the data are presented as mean ± standard deviation (SD). The GraphPad Prism 8.0 software package was used for statistical analysis and visualization. The data were analyzed with an unpaired Student’s t test without assuming equal variance and one-way analysis of variance. P < 0.05 was considered to indicate statistical significance.