Authorization of the tick vaccine field trial

The clinical vaccine field trial was authorized by the National Biosafety Committee (NBC 01/2022) of Uganda National Council for Science and Technology (UNCST-A191ES), and National Drug Authority (NDA - VTC 01/2022).

Selection of trial sites and experimental animals

The selection of trial sites was undertaken in compliance with NDA guidelines on the conduct of ectoparasiticide field trials in 2017 and National Guidelines for Use of Animals in Research and Teaching 2021. The guidelines provide as implemented in this field trial that (a) trial sites may be located in at least two agro-ecological zones to cater for tick diversity and trial product stability under the different climatic conditions and the choice of five sites was done to care of the thermolability of vaccine, (b) inclusion of the different cattle breeds commonly reared in Uganda in their traditional localities, notably Shorthorn Zebu, Boran, Ankole longhorn, and Friesian crosses, (c) use of government-owned cattle farms by National Agricultural Research Organization (NARO) and Minister of Internal Affairs (UPS) to permit the availability of trial cattle up to the end of the study period and qualified veterinary personnel employed by the government. The field trial was designed at different Ugandan locations in collaboration between NaLIRRI/NARO (Uganda) and SaBio/IREC (Spain) (Fig. 1). Locations included Mbarara ZARDI (Mbarara 1 and 2 are located on the same farm Mbarara ZARDI but in Mbarara 1 cattle was confined in grazing paddocks while Mbarara 2 is not fully confined and thus cattle were allowed to access pasture and water resources beyond trial paddocks and those only some analyses were conducted separately for Mbarara 1 and 2), Ugandan government prison (UPS) farms Kiburara and Isimba, NaLIRRI Maruzi and Nabuin ZARDI (Fig. 1). Experimental cattle were selected using the following inclusion (healthy cattle with more than two-years-old and including both sexes) and exclusion (sick/unhealthy cattle or planned for disposal sales before the trial ends) criteria. The trial cattle confinement was undertaken in compliance with the National Guidelines for Confinement for Regulation of Research with Genetically Modified Organisms and Microbes (2007). Cattle management includes confined paddock with supervised relaxation for higher exposure to ticks (Mbarara ZARDI, Maruzi NaLIRRI, Nabuin ZARDI) or strictly in paddock that mimics intensive management (UPS Kiburara, UPS Isimba).

Recombinant SUB production and vaccine treatment formulations

The Rhipicephalus appendiculatus SUB (MT241515; https://www.ncbi.nlm.nih.gov/nuccore/MT241515), selected based on the highest tick cross-species protection in Bos indicus and crossbred cattle in Uganda, was manufactured under Good Laboratory Practice (GLP) conditions at SaBio, IREC, Spain following the previously described protocol17. Vaccine treatments with SUB recombinant protein or PBS control were formulated in Montanide ISA 50 V2 (Seppic, Paris, France) in a stable water in oil (W/O) emulsion at a concentration of 50 μg SUB per ml and stored at 4 °C.

Experimental design

Treatments produced under GLP conditions were coded as Treatment 1 and Treatment 2 at SaBio/IREC. Treatment, sampling, and processing were conducted in a randomized double-blind multi-site field trial by NaLIRRI/NARO in collaboration with personnel at cattle farms. Sample and data analysis were conducted for comparison between treatments by SaBio/IREC and NaLIRRI/NARO. Then, at the completion of the trial, treatments were uncoded by SaBio/IREC to complete comparative analysis between SUB vaccine (Treatment 1) and control (Treatment 2) efficacy, effectiveness, and safety.

For treatment, cattle were injected intramuscularly in the neck muscles with 2 ml vaccine (100 μg SUB per dose) or PBS control with 3 doses on days zero, 30±1 and 181±1 at 27/10/2022, 30/11/2022, 30/04/2023 (Mbarara), 9/11/2022, 10/12/2022, 10/05/2023 (Kiburara), 10/11/2022, 11/12/2022, 12/05/2023 (Isimba), 15/03/2023, 17/04/2023, 18/09/2023 (Maruzi), and 16/03/2023, 18/04/2023, 20/09/2023 (Nabuin).

At different days post-vaccination (dpv; administration of the first dose at zero dpv), tick data (32, 65, 93, 124, 153, 182 dpv at Mbarara 1; 31, 99, 131, 196 dpv at Mbarara 2; 35, 63, 73, 167 dpv at Maruzi), blood samples (zero, 30, 180 dpv at Mbarara, Kiburara, and Maruzi) and vaccine safety associated with cattle wellbeing records (zero, two, four, 13, 28, 30 dpv followed by every two weeks for nine months post-vaccination (mpv) at Mbarara 1 and 2; six days prior treatment, two, four, 18, 33, 35 dpv followed by every two weeks for eight mpv at Isimba; 41, 90, 92 dpv followed by every two weeks for five mpv at Maruzi; six days prior treatment, two, four, 19, 33, 35 dpv followed by every two weeks for seven mpv at Kiburara; 49, 81, 83 dpv followed by every two weeks for five mpv at Nabuin) were collected for analysis. Additionally, tick data was collected at 327 dpv and 251 dpv at Mbarara 2 and Maruzi, respectively. Samples and data were always collected before vaccination when treatments were applied to cattle (Supplementary Data 1-3).

Acaricide use was stopped at 0 dpv and before the beginning of the trial included Duodip (Chlorpyrifos 500 g/l and cypermethrin 50 g/l) twice a week except for Nabuin ZARDI where it was applied only once a week. The incidence of TBD included between 40 (Maruzi and Nabuin) and 50 (Mbarara, Kiburara and Isimba) cases per year of TBD. The reported TBD included East Coast fever (ECF, Theileria parva), babesiosis (Babesia bigemina and Babesia bovis), anaplasmosis (Anaplasma marginale and Anaplasma centrale), heartwater (also known as cowdriosis; Ehrlichia ruminantium, formerly Cowdria ruminantium), and CCHF (CCHFV34). Cattle in contact with wildlife only occurred at Mbarara and Kiburara with buffalo.

Tick infestations

Tick species with highest infestations and prevalence were analyzed in the study according to locations and included one-host tick species, Rhipicephalus decoloratus, two-host tick species, Rhipicephalus evertsi, and three-host tick species, R. appendiculatus and Amblyomma variegatum. As previously described17, adult engorged ticks were collected, counted, weighed individually and incubated for oviposition. The eggs mass per female tick was weighed and incubated for hatching. The recovered larvae per egg batch were weighed.

Collection of cattle blood samples for serum and DNA extraction

Blood samples were collected from individual animals at different locations. From these samples, 400 µl were added with a micropipette to a labeled filter paper (Whatman grade 4 filter paper; Whatman, Maidstone, UK) and let it dry for 10 h. One filter was prepared for each serum and DNA extraction. For serum extraction, filter papers were folded into a 1.5 ml Eppendorf tube (Merck KGaA, Darmstadt, Germany) with 400 µl of sterile 1X phosphate-buffered saline (PBS) and incubated at 4 °C for 12 h. Then, tubes were agitated to cut out the bottom and put it on an empty capless blood collection tube (Merck KGaA) for centrifugation at 1500 × g for 10 min to collect serum at the bottom of the tube. For DNA extraction, phenol-chloroform protocol using Tri Reagent (Sigma-Aldrich, Burlington, MA, USA) was used according to the manufacturer’s instructions. Briefly, a one quarter of each filter paper was cut and transferred into a 1.5 ml tube containing 250 µl Tri Reagent solution. The filter papers were soaked and incubated for 10 min at room temperature (RT). Then, the tip of the tubes was cut-off and placed into 5 ml collection tubes to centrifuge at 750 × g for one min. Filter papers were discarded and the flow-through with blood and Tri Reagent solution was used for DNA extraction. The concentration, quality, and purity of DNA were checked using a spectrophotometer (NanoDrop One, Thermo Scientific, Waltham, MA, USA) and then stored at –80 °C until analysis.

Characterization of tick-borne pathogens in cattle blood DNA and serum samples

Conventional PCR assays with forward (F) and reverse (R) primers (5´- 3´) were used for the detection of tick-borne Anaplasma spp. RpoB 16S rRNA gene (RpoB 16SF (F):

GCTGTTCCTAGGCTYTCTTACGCGA, RpoB 16SR (R):

AATCRAGCCAVGAGCCCCTRTAWGG), Rickettsia spp. 16S rRNA gene (FD1 (F):

AGAGTTTGATCCTGGCTCAG, Rc16 (R):

AACGTCATTATCTTCCTTGC), Ehrlichia spp. 16S rRNA gene (EHR16SF (F):

GGTACCYACAGAAGAAGTCC, EHR16SR (R):

TAGCACTCATCGTTTACAGC), and piroplasmids 18S rRNA gene (PIRO A (F):

AATACCCAATCCTGACACAGGG, PIRO B (R):

TTAAATACGAATGCCCCCAAC)35,36,37,38 in cattle blood samples from 99 animals that were collected at 0 dpv (n = 57), 30 dpv (n = 41) and 180 dpv (n = 12) (Supplementary Table 6). Of them, 88 cattle were sampled once and 11 were longitudinally surveyed at d0 and d30. The reaction volume was 25 μl, including 12.5 μl of PCR Master Mix (Promega Corporation, Madison, WI, USA), one μl of each primer at 10 μM, one μl of DNA and 9.5 μl of nuclease-free water. The PCR products were visualized through electrophoresis in 1.5% agarose gels using GelRed® Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA). A selection of the positive samples was sequenced by Sanger sequencing (Secugen S.L., Madrid, Spain). Sequences were compared with those available in GenBank by using a Basic Local Alignment Search Tool (BLAST) search (http://www.ncbi.nlm.nih.gov/blast). Sequences of pathogens identified at the species level were submitted to GenBank (https://www.ncbi.nlm.nih.gov/genbank/; Supplementary Data 4).

The detection of antibodies against Crimean-Congo haemorrhagic fever virus (CCHFV) was performed using the IDScreen CCHF Double Antigen Multispecies commercial ELISA kit (IDVet, Grabels, France) in cattle serum samples from 101 animals. Samples were collected at zero dpv (n = 60), 30 dpv (n = 41) and 180 dpv (n = 12), including 89 cattle sampled once and 12 cattle longitudinally surveyed at d0 and d30. The test was performed according to the manufacturer’s instructions. Briefly, 30 μl of each serum sample, and positive and negative controls were diluted with 50 μl of the kit diluent and incubated for 45 min at 25 °C. After a washing procedure, 50 μl of conjugate was added to each well, followed by an incubation for 30 min at 25 °C. A second washing procedure was performed and 100 μl of substrate solution was added to each well. After incubation for 15 min in the dark at 25 °C, the reaction was stopped with the provided stop solution. Using a SmartSpecTM Plus spectrophotometer (Bio-Rad Laboratories Inc., Hercules, CA, USA), the optical density of each well was measured at 450 nm. Determination of cut-off for sero-positive and sero-negative samples for CCHFV was performed according to the kit criteria.

Infection prevalence was estimated from the proportion of positive samples to the total number of samples tested. Bivariate associations between the presence of tick-borne pathogens and explanatory variables (location and group) were analyzed using the Pearson’s chi-squared test or Fisher’s exact test, as appropriate. Additionally, the McNemar’s test was used to investigate the association between PCR positivity and sampling time for animals that were longitudinally surveyed. Analyses were performed using R software version 4.1.339 and differences were significant with p < 0.05 for a double‐sided test. Confidence interval (CI) at 95% confidence level (Z-value = 1.96) was calculated as CI = Average ± Z x standard deviation (SD)/√n using the Confidence Interval Calculator (Calculator.net, https://www.calculator.net/confidence-interval-calculator.html).

Vaccine efficacy E

Allen and Humphreys8 proposed the analysis of variables associated with tick life cycle using vaccine formulations with midgut protein extracts. This approach was later revised and applied for vaccines with recombinant antigens for the control of tick infestations under experimental and natural conditions9,10.

Currently, vaccine efficacy E for the control of tick species in pen trials under controlled conditions is based on the effect in the reduction of tick infestations, oviposition, and fertility as E (%) = 100 [l - (CRT x CRO x CRF)], where CRT, CRO, and CRF are the reduction in the number of adult female ticks, oviposition and egg fertility compared with the control group40. The formula was then adapted to three-host tick species as E (%) = 100 [1 - (RL x VL x RN x VN x CRT x CRO x CRF), where RL and VL are the reduction in engorged and molting of tick larvae and RN and VN are the reduction in engorged and molting of tick nymphs41,42.

Accordingly, the final calculation of vaccine efficacy E considers available information on tick immature stages as:

E (%) = 100 x [1 – (TV/TC x OV/OC x FV/FC x LV/LC x NV/NC)], where TV and TC are female ticks from vaccinated and control groups, respectively, OV and OC are egg weight from ticks in vaccinated and control groups, respectively, FV and FC are fertility (percent of egg hatching and producing larvae) from ticks in vaccinated and control groups, respectively, LV and LC are engorged larvae from vaccinated and control groups, respectively, and NV and NC are engorged nymphs from vaccinated and control groups, respectively.

Vaccine effectiveness Ee

Vaccine effectiveness Ee is the evaluation of efficacy under field conditions considering locations with different characteristics and infestations by multiple tick species41,42. This information is essential for the approval of vaccine formulations for registration and commercialization to improve livestock health and production.

For the evaluation of vaccine effectiveness Ee against multiple tick species infesting the same host, the combined effect was calculated as:

Ee (%) = 100 x [1 – (TVCsp1 x TVCsp2 x TVCspN)], where (TVC)sp = TV/TC x OV/OC x FV/FC x LV/LC x NV/NC for each tick species sp1, sp2, … spN.

Additional considerations for evaluation of effectiveness Ee include:

Fed female tick weight as a marker of tick fitness, Ew (%) = 100 x (1- WV/WC), where WV and WC are mean female tick weight from the vaccinated and control groups, respectively.

Total (larvae, nymphs and adults) tick counts for all tick species infesting the same host, Ev (%) = 100 x [1 – (TV/TC x LV/LC x NV/NC)].

Reduction in the number of infested cattle (R) after comparison of vaccinated and control animals at around 6 months after first vaccine dose administration.

Total integrated vaccine efficacy/effectiveness E/Ee

The average for all locations of vaccine efficacy E, effectiveness Ee, Ev, and R was used for the estimation of total integrated vaccine efficacy/effectiveness (EeI) as EeI (%) = 100 x [1 - [(1 - (E/100)) x (1 - (Ee/100)) x (1 - (Ev/100)) x (1 - (R/100))]]43,44.

Data analysis for tick infestations and vaccine efficacy and effectiveness

The confidence interval was calculated as described above for tick-borne pathogens. As previously described for SUB vaccine field trial16, tick infestations (female ticks/animal) were compared between vaccinated and control groups throughout the trial using a One-way ANOVA with post-hoc Tukey Honestly Significant Difference HSD test (https://astatsa.com/OneWay_Anova_with_TukeyHSD/) (p = 0.05). The number of female ticks per animal at one and around 6 months after vaccination was compared between vaccinated and control groups by Student’s t-test with unequal variance (p = 0.05).

Vaccine safety

During the trial, cattle were maintained with freedom to roam around and access to water and feed. Vaccine safety and cattle wellbeing were evaluated by recording in response to treatments (n = 36-37 animals/treatment at dates disclosed in the experimental design; Supplementary Data 3) (a) local reactions/skin coat (score 10-smooth even/regular hair pattern and kempt, 20-rough shaggy irregular hair pattern; score 10 is considered normal), (b) body temperature (normal, 38.5–39.0 °C), (c) body condition (score 1-extremely thin, 2-thin, 3-moderate, 4-fat, 5-obese; scores 2-3 are considered normal), (d) respiration/breeding (score 10-normal, 20-not normal/labored), (e) feeding (score 10-normal grazing consistently, 20-limited when animal takes long breaks not feeding while lying down or standing, 30-abnormaly increased intake), (f) locomotion/movement (score 0-normal even walking, 1-slightly lame uneven walking, 2-lame with arched back and head bob when walking, 3-severely lame with great difficulty when walking), (g) demeanor (score 0-dull when animal generally not feeding and lays down with limited response to stimuli, 1-active when animal generally involves actively in all activities such as feeding, 2-retless/hyper when animal makes frequent movements and charging; score 1 is considered normal), and (h) mortality. In Nabuin, fecal samples were collected and evaluated (score 1-normal consistence, 2-diarrhoea, 3-hard). Additionally, blood samples were collected at 0, 30, 60 and 90 dpv from cattle at different locations (Mbarara, Isimba, Kiburara, Nabuin, Maruzi) and submitted to Lancet Laboratories Uganda Limited (Nakasero Hill Lab, Plot 1 Kyadondo Rd., Kampala, Uganda) for hematology analysis in blood using a chemical analyzer (COBAS Integra 400; Roche Holding AG, Basel, Switzerland) and serum (Hitachi 717 Chemistry Analyzer; Roche Holding AG). Blood and serum biomarkers included WBC, white blood cells; lymphocytes; RBC, red blood cells; hemoglobin; hematocrit; MCV, mean cell volume; MCH, mean cell hemoglobin; MCHC, mean cell hemoglobin concentration; RET/RDW, reticulocytes; platelets; neutrophils; basophils; eosinophils; monocytes; TBIL, total bilirubin; CBIL, conjugated bilirubin; ALP, alkaline phosphatase; GGT, gamma-glutamyl transferase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; TP, total protein level; ALB, albumin; CHOL, cholesterol; LDLCHOL, low-density lipoprotein (LDL) cholesterol; HDLCHOL, high-density lipoprotein (HDL) cholesterol; NONHDL, non-HDL cholesterol; CHOL/HDL, CHOL to HDL ratio; TRIG, triglycerides; UREA, urea nitrogen; CREA, creatinine. References values were provided by Lancet Laboratories Uganda Limited. Results were compared between treatments at each time point by Student’s t-test with unequal variance (p = 0.05) and throughout the trial for each treatment by One-way ANOVA with post-hoc HSD test (https://astatsa.com/OneWay_Anova_with_TukeyHSD/) (p = 0.05).

Antibody titers and correlation with engorged tick weight

Anti-SUB IgG antibody titers were determined as previously described16 (Supplementary Data 4). The 96-well ELISA microplates (Merck KGaA) were coated with 0.1 μg/well SUB in carbonate/bicarbonate buffer and incubated overnight at 4 °C. Plates were washed with 100 μl/well of washing buffer (PBS, 0.05% Tween 20, pH 7.4), blocked for 1 h at RT with 100 μl/well of blocking buffer (PBS, 2.5% skim milk, pH 7.2), and washed for three times with 100 μl/well washing buffer. Then, 100 µl of bovine serum diluted 1:100 in blocking buffer was added to the wells and the plate was incubated at 37 °C for one h. Plates were washed as before and 100 μl/well of anti-bovine IgG-HRP conjugates (Merck KGaA) diluted 1:10000 in blocking buffer were added to the wells and incubated for 1 h at RT. Plates were washed again as before and 100 µl/well of 3,3′,5,5′-Tetramethylbenzidine (TMB; Abcam, Waltham, Boston, USA) were added and incubated in the dark for 15 min at RT. The reaction was inhibited with the addition of 50 μl H2SO4 3N and the absorbance was measured at 450 nm optical density (O.D.). For data analysis, average of control O.D. values (plate wells without SUB; n = 5) were subtracted from each sample and results compared for each timepoint (0, 30 and 180 pdv) between SUB-vaccinated and PBS-treated groups by Student´s t-test with unequal variance (p = 0.05) and between different timepoints by One-way ANOVA with post-hoc HSD test (https://astatsa.com/OneWay_Anova_with_TukeyHSD/) (p = 0.05). Correlation analysis between anti-SUB IgG antibody titers and engorged Rhipicephalus spp. tick weight was conducted as previously described6,25,31. A Pearson correlation coefficient (r) was calculated in Mbarara animals with data available at different dpv (https://www.socscistatistics.com/tests/pearson/).