Animals

All mice were housed in an authorized animal facility at Kunming Institute of Zoology, Chinese Academy of Sciences (CAS). Mice were housed in individually ventilated cages using a 12-hour light/12-hour dark cycle. All animal experiments used in this study were conducted according to the guidelines approved by the Ethics Committee of Kunming Animal Research Institute. Approval No: SMKX-20200710-37.

Generation of RetSat-knockout mice

Construction of gene editing mice was performed by Cyagen Biosciences, Inc. Briefly, exons 2–11 of RetSat gene were selected to be target site covering 6406 base pair. Cas9 endonuclease and 4 sgRNAs were co-injected into fertilized eggs and transplanted into the recipient female mouse. Two heterozygous females and two heterozygous males were born in generation P0. The pups were genotyped by PCR and sequencing analysis. Two pairs of primers were designed for identifying of genotype, the sequence of primer 1 (5’-3’, F: GCTTCTTCCAAAGAAACCCAGTTC, R: CTGAAAGAATTCTGACTCCAAGCA, product size: 483 bp), primer 2 (5’-3’, F: CTTATTGCCTTTTCTTTCCTCGCTT, R: AAGCCTTACCAGTGTCAAATTCAAG, product size: 682 bp). Mouse genomic DNA was extracted by standard method using DNA extraction kit (TIANGEN, Cat. no. DP304). 1 µg DNA was used as the amplification template for PCR experiment, and the PCR reaction was performed by Premix Ex Taq (Takara, Cat. no. RR902A) in a 25 µL reaction system. Reaction condition was initial denaturation at 94 °C for 3 min, denaturation at 94 °C for 30 s, annealing at 60 °C for 35 s, extension at 72 °C for 35 s and 35 cycles from second step, finally additional extension at 72 °C for 5 min. DNA bands were detected by 1.5% agarose gel electrophoresis. Homozygotes showed one band of 483 bp, wildtype allele showed one band with 682 bp and heterozygotes showed two bands both (Supplementary Fig. 1c).

Derivation of stem cell lines from RetSat wild-type/knock-out mouse embryos

mESCs were isolated from RetSat wild-type/knock-out mice followed by standard operating procedures [24]. In brief, administer 5 IU PMSG (Acmec, Cat. no. AP9970) injection to 4–6 weeks old nulliparous female mice from the C57BL/6J strain, after 48 h, administer 5 IU HCG (Acmec, Cat. no. C79010) injection, and mate the females with 8–10 weeks old male mouse at 1:1 ratio. After checking the copulatory plugs, the females were separated from the males next day. The female mice were euthanized by cervical dislocation 45–48 h post-coitum. The oviducts were cut off after dissection, followed by flush with Hepes-buffered CZB medium (HCZB) and 2-cell embryos were collected. The embryos were picked up using the mouth pipette apparatus into the KSOM medium and cultured embryos until to the blastocyst stage at 37 °C under 5% CO2 culture conditions. The zona pellucida of embryos were removed using acidic Tyrode’s solution followed by seeding one zona-free blastocyst on the feeder cells in each plate well. Monitoring the outgrowth formation, change half of 2i + LIF culture medium every other day. The outgrowth was digested into pieces after 6–8 days culture in order to release the ICM cells and further expansion.

Cell lines and culture

Mouse embryonic fibroblasts (MEF) were isolated from C57BL/6J mouse embryos at Embryonic day 13.5 (E13.5). Human somatic fibroblasts (HEL-1) were purchased from the Conservation Genetics CAS Kunming Cell Bank (China). Mouse embryonic stem cells (mESCs, line D3) and human embryonic stem cells (hESCs, line H9) were kindly provided by Professor Ping Zheng laboratory at Kunming Institute of Zoology, CAS. HEK293 cells were purchased from ATCC (Cat. no. CRL-1573).

MEF, HEL-1, and HEK293T cells were cultured in DMEM medium (Gibco, Cat. no. C11995500BT) consisting of 10% FBS (Gibco, Cat. no. 16000-044) and 1% penicillin/streptomycin supplement (Gibco, Cat. no. 15140122). The mouse induced pluripotent stem cells (miPSCs) were reprogrammed from ICR mouse embryonic fibroblasts (MEF) by transduction of retroviral vectors encoding Oct-4/Sox2/Klf4/c-Myc transcription factors, OSKM were kindly donated from Professor Zheng Ping’s laboratory at Kunming Institute of Zoology, CAS. miPSCs were cultured on feeder with 2i/LIF medium. hESCs were cultured in Human Pluripotent Stem Cell Medium (Cauliscel, Cat. no. 400105). mESCs were cultured on plates coated with 0.1% gelatin (Amersco, Cat. no. 9764) in culture media containing Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, Cat. no. C11995500BT) supplemented with 15% FBS (Gibco, Cat. no. 16000-044), 2 mM Gluta MAX Supplement (Gibco, Cat. no. 35050061), 100 U/mL penicillin and 100 µg/mL streptomycin (Gibco, Cat. no. 15140122), 0.1 mM β-mercaptoethanol (Gibco, Cat. no. 21985023), 0.1 mM nonessential amino acids (Gibco, Cat. no. 11140-035), 1 mM sodium pyruvate (Gibco, Cat. no. 11360070), supplemented with two small molecular inhibitors 1 µM PD0325901 (Selleck, Cat. no. S1036), 3 µM CHIR99021 (Selleck, Cat. no. S1263) and 1000 U/mL LIF (Millipore, Cat. no. ESG1106).

Differentiation assay of mESCs

For the mESCs differentiation assay, feeder was replaced with 0.1% gelatin. For spontaneous differentiation, mESCs were cultured in LIF-free medium for 15 days. For all-trans retinoic acid induced neuroectodermal and extraembryonic endoderm differentiation, mESCs were cultured in LIF-free medium supplemented with 250 nM all-trans retinoic acid (Sigma, Cat. no. 554720) for 48 h. After treatment, fresh media were changed every two days, cells were harvested at day 15 for gene expression analysis and immunostaining.

Lentivirus mediated RetSat gene expression

Mouse RetSat coding region was constructed into pTOMO-IRES-EGFP vector (Addgene plasmid.

#26291) through BamHI and XbaI digest sites. The lentiviral vectors were transfected into HEK293T.

cells along with the packaging plasmids psPAX2 and pMD2.G at a ratio of 5:2.5:1 using Lipofectamine 3000.

(Invitrogen, Cat. no. L3000015). Lentivirus was harvested 48 h post transfection and fltered with 0.45 μm flter (Millipore, Cat. no. SLHV033RB). RetSat knockout mESCs were infected with lentivirus and screened with 3 µg/mL puromycin 72 h post infection [25].

Chemicals and antibodies

Aphidicolin was purchased from Sigma-Aldrich (Cat. No. 38966-21-1; 1MG). Reversine was purchased from Sigma-Aldrich (Cat. No. 656820-32-5; 1MG). The following antibodies were obtained from the indicated suppliers: rabbit anti-RetSat polyclonal antibody (Invitrogen, Cat. No. PA5-65443, 1:1000 for immunoblotting), mouse anti-RetSat monoclonal antibody (made in our laboratory, we have isolated and purified a high concentration of single epitope specific RetSat monoclonal antibody at a concentration of ∼ 0.8 mg/ml after fusion culture and screening of hybridoma cells from mice immunized with RetSat antigen, 1:400 for immunoblotting, 1:20 for immunofluorescence and 3 µg for immunoprecipitation), rabbit anti-Aurora B polyclonal antibody (Abcam, Cat. No. ab2254, 1:500 for immunofluorescence), rabbit anti-Oct4 monoclonal antibody (Abcam, Cat. No. ab181557, 1:1000 for immunoblotting), rabbit anti-Sox2 monoclonal antibody (Abcam, Cat. No. ab92494, 1:1000 for immunoblotting), rabbit anti-Nudcd2 polyclonal antibody (Proteintech, Cat. No. 21205-1-AP, 1:1000 for immunoblotting), mouse anti-Smc1a monoclonal antibody (Proteintech, Cat. No. 66987-1-Ig, 1:1000 for immunoblotting), rabbit anti-Smc3 polyclonal antibody (Proteintech, Cat. No. 14185-1-AP, 1:500 for immunoblotting), mouse anti-Gapdh monoclonal antibody (Beyotime, Cat. No. AF0006, 1:1000 for immunoblotting), mouse anti-β-Actin monoclonal antibody (Sigma-Aldrich, Cat. No. A1978, 1:2000 for immunoblotting), rabbit anti-Histone H2A polyclonal antibody (Beyotime, Cat. No. AH419, 1:1000 for immunoblotting), mouse IgG antibody (Beyotime, Cat. No. A7028, 1 µg for immunoprecipitation). The secondary antibodies used were raised against mouse conjugated with Alexa Flour 594 (ThermoFisher, Cat. no. A-11005, 1:500 for immunofluorescence), against rabbit conjugated with Alexa Flour 488 (ThermoFisher, Cat. no. A-11008, 1:500 for immunofluorescence), goat anti-mouse IgG antibody conjugated with HRP (Sigma-Aldrich, Cat. no. A4416, 1:2000 for immunoblotting), goat anti-rabbit IgG antibody conjugated with HRP (Sigma-Aldrich, Cat. no. A0545, 1:3000 for immunoblotting).

Immunoblotting

Cells were gently washed with ice-cold PBS and collected by cell scraping. The cells were lysed on ice for 30 min with RIPA lysis buffer (150 mM NaCl, 1% Triton X-100, 0.1% SDS, 50 mM Tris Base, 1 mM EDTA in ddH2O, PH = 7.4) containing of 1X proteinase inhibitor cocktail (BIMAKE, Cat. no. B14001) after centrifugation, then sonication was performed at 30 HZ for 5 min (Sonics, Cat. no. VCX130/130 PB). Protein concentration was quantified by Bradford method (Beyotime, Cat. No. P0006). Equal amount of protein was separated on SDS-PAGE gels using running buffer and transfer to 0.45 μm PVDF membranes (Millipore, Cat. no. IPVH00010) at 300 mA for 90 min in ice-cold transfer buffer. Membranes were blocked with 5% skim milk (Oxoid, Cat. no. LP0033B) in PBST at room temperature for 1 h, incubated with primary antibody at 4 °C overnight, washed with TBST 3 times for 5 min each time, followed by incubation with HRP-conjugated secondary antibodies diluted with TBST containing 3% skim milk at room temperature for 1 h, finally washed with TBST for 3 times and blots were developed using Immobilon Forte Western HRP substrate (Millipore, Cat. no. WBKLS0500) with Luminescence Imaging System (Tanon 5200).

Immunofluorescence

Coverslips of 24-well plate (NEST, Cat. no. 801007) were coated with Matrigel (BD Biocoat, Cat. no. 354277) diluted 1:10 in culture medium for mESC/miPSC/hESC cells, or coated with 100 µg/mL Poly-L-Lysine (Sigma-Aldrich, Cat. no. P1399) for MEF/HEL-1/HEK293T cells. The cells were seeded onto coverslips in 24-well plate before fixed with 4% paraformaldehyde (Sigma-Aldrich, Cat. no. P6148) at room temperature for 1 h. Then cells were washed with PBST and permeabilized with 0.3% Triton X 100 solution (Sigma-Aldrich, Cat. no. T8787) for 15 min at room temperature. Cells were blocked with 5% bovine serum albumin (Sigma-Aldrich, Cat. no. A1933) in PBS for 1 h at room temperature, followed by incubation with primary antibody at 4 °C overnight, washed with PBST for 3 times and incubated with secondary antibody 1 h at room temperature. After washed with PBST 3 times, the coverslips were inverted onto a drop of anti-fading mounting medium (Solarbio, Cat. no. S2110 containing DAPI). Images were taken using Olympus FV1000 confocal microscopes under 100X lens.

Real-time RT-PCR

The cells were centrifugally collected after digestion with trypsin. Tissues were ground into homogenates by freezing grinder (LUKYM, Guang Zhou, China) followed by lysed with QIAzol Lysis Reagent (QIAGEN, Cat. no. 79306). Total RNA was extracted using RNeasy Mini Kit (QIAGEN, Cat. no. 74104) and determined concentration by Nanodrop 2000. First-strand complementary DNA was synthesized by PrimeScript RT reagent Kit (Takara, Cat. no. RR037Q). qPCR was performed by standard protocol using GoTaq qPCR Master Mix (Promega, Cat. no. A6001). The primers sequences used for quantitative RT-PCR are as follows: mouse RetSat (forward: 5’-GCACTTGTTGCCAGAGACTGTC-3’, reverse: 5’-TTCAGGTCCTCCTTGGTGCCTT-3’); mouse Oct4 (forward: 5’-CGGAAGAGAAAGCGAACTAGC-3’, reverse: 5’-ATTGGCGATGTGAGTGATCTG-3’); mouse Sox2 (forward: 5’-GCGGAGTGGAAACTTTTGTCC-3’, reverse: 5’-GGGAAGCGTGTACTTATCCTTCT-3’); mouse Nanog (forward: 5’-CACAGTTTGCCTAGTTCTGAGG-3’, reverse: 5’-GCAAGAATAGTTCTCGGGATGAA-3’) ; mouse Gapdh (forward: 5’-TGACCTCAACTACATGGTCTACA-3’, reverse: 5’-CTTCCCATTCTCGGCCTTG-3’). Gene expression was quantified relative to housekeeping gene Gapdh as an internal control based on the threshold cycle (Ct) at fluorescence intensity. Relative expression of target gene was calculated using formula 2−(∆Ct(sample)− ∆Ct(control)).

Immunohistochemistry

Formalin-fixed paraffin embedded tissue Sect. (4 μm) were deparaffinized and hydrated by incubating sections in three washes of environmental dewaxing dip wax transparentize solution (Servicebio, Cat. no. G1128-1 L) for 15 min each, followed by two washes of 100% ethanol for 10 min each, two washes of 95% ethanol for 5 min each, 90% ethanol for 3 min, 80% ethanol for 2 min, 70% ethanol 1 min and three washes of ddH2O for 5 min each. Antigens were retrieved by boiling slides in citrate antigen retrieval solution (Beyotime, Cat. no. P0081), maintained at a sub-boiling temperature for 8 min and cooled to room temperature. Hematoxylin and eosin (HE) staining was conducted following standard procedures. Briefly, tissue sections were stained with hematoxylin solution (Servicebio, Cat. no. G1004) for 3 min followed by water rinse for 1 min. Then the sections were treated with 1% hydrochloric acid solution for 15 s, quickly processed sections in 1% ammonium hydroxide for 15 s, followed gentle rinse of water for 1 min. Then the sections were stained with eosin solution (Servicebio, Cat. no. G1005) for 3 min and followed by dehydration with graded alcohol and clearing in xylene. Seal the slides with neutral resin and dry the resin at room temperature.

Immunoprecipitation

The mESCs were treated with 0.05 µg/ml nocodazole (Solarbio, Cat. no. IN0710) for 6 h at 37 °C under 5% CO2 culture conditions, which synchronized cells to G2/M phase. After remove nocodazole, cells were lysed with RIPA buffer, cell precipitates collected from each 150 mm2 dishes add 1 mL RIPA lysis buffer. For immunoprecipitation (IP) assay, 25 µL protein A/G agarose beads (YEASEN, Cat. no. 36403ES03) were pre-washed three times with RIPA, centrifuged at 4500 rpm for 2 minutes and supernatant was removed, then incubated cell lysates with the beads in the absence of an antibody to control for non-specific binding, under the condition at 4 °C on 4-dimensional rotator for 3 h. After 4500 rpm centrifugation for 2 minutes and gently suck out supernatant, add 3 µg RetSat primary antibody and incubated at 4 °C on 4-dimensional rotator for 17 h, 1 µg mouse IgG antibody (Beyotime, Cat. no. A7028) was added another as negative control. Followed by pre-washed of RIPA buffer, 60 µL protein A + G beads were added into supernatant from previous step, incubated antibody-conjugated beads at 4 °C on 4-dimensional rotator for 5 h. The supernatant was centrifugally sucked out and precipitated beads were washed with RIPA for 6 times, the last three times change wash buffer to hyperhaline RIPA (300 mM NaCl, 1% Triton X-100, 0.1% SDS, 50 mM Tris Base, 1 mM EDTA in ddH2O, pH = 7.4), the beads were wash on 4-dimensional rotator for 7 min each time, and re-suspended the beads in 50 µL 2X SDS loading buffer (Beyotime, Cat. no. P0015) and eluted protein complexes from beads by boiling for 10 min, balanced to room temperature, centrifuge at 15,000 rpm for 5 min then subjected to immunoblotting analysis. The SDS-PAGE gel of major protein was stained with silver performed by standard procedures using the Silver Stain Kit (Beyotime, Cat. no. P0017S). The mass spectrum analysis was conducted by Novogene Company.

RNA-seq analysis

For mESCs RNA-seq analysis, total RNA was extracted by RNeasy Mini Kit (QIAGEN, Cat. no. 74104). The quality of isolated RNA was critically assessed by Berry Genomics (https://www.berrygenomics.com, Beijing, China). RNA samples for sequencing kept a RIN value greater than 8. Total transcriptome expression analysis was performed. For data analysis, reads mapping was performed with hisat2_2.1.0, featureCounts_2.0.2 was used to count the reads number mapped to each gene, differential gene expression analysis was implemented using DESeq2_1.34.0, DESeq2 was also used to calculate fold change (> 1.5) and P value (p value < 0.05 and p.adj < 0.05).

Teratoma formation assay

The mESC cells were digested with 0.05% Trypsin (Thermo Fisher, Cat. no. 15050065), centrifuged and re-suspended cells in 1 mL PBS. Cell density was measured by cell counter, and Matrigel with equal volume was added to make the cell density of 2 × 106 cells/100 µL. Teratoma formation experiments were performed in 8-week-old B-NSG immunodeficient female mice (NOD.CB17-PrkdcscidIl2rgtm1/Bcgen) (Biocytogen, Cat. no. 110586). Cells were injected subcutaneously into the outside of the left hind leg of the recipient mice. Body weight and tumor size were measured every three days. After 21 days, the mice were sacrificed and tumors were removed for histological analysis.

Grading of immature teratomas

HE-stained sections of teratomas were used for histological grading, we used the modified Thurlbeck-Scully histological grading system for solid ovarian teratomas proposed by Norris et al [24]. The number of neural rosettes was observed in 40X field of view for malignancy grading, grade I has less than 1 neural rosettes in each 40× field of view states as benign teratoma, grade II has 1–3 neural rosettes in each 40× field of view with low malignancy, and more than 3 in each 40× field of view is grade III with malignancy.

Statistical analysis

Data are showed as mean ± SD, differences between groups were determined by unpaired, two-tailed Student’s t test. Statistical analysis was performed using GraphPad Prism software 9 (GraphPad Software, La Jolla, CA, USA). *P < 0.05; **P < 0.01, ***P < 0.001, P value < 0.05 was considered statistically significant.