Mice

NOD.Cg-PrkdcSCIDIl2rgtm1Wjl/SzJ (NOD/SCID/IL-2Rγ−/−, NSG) mice were maintained in the animal facilities of University of California, Los Angeles (UCLA). Here 6–10 week-old female mice were used for all experiments unless otherwise indicated. All animal experiments were approved by the Institutional Animal Care and Use Committee of UCLA. All mice were bred and maintained under specific pathogen-free conditions, and all experiments were conducted in accordance with the animal care and use regulations of the Division of Laboratory Animal Medicine at the UCLA.

Media and reagents

The X-VIVO 15 Serum-Free Hematopoietic Cell Medium was purchased from Lonza. The StemSpan T Cell Generation Kit, comprising the StemSpan SFEM II Medium, the StemSpan Lymphoid Progenitor Expansion Supplement, the StemSpan Lymphoid Progenitor Maturation Supplement, the StemSpan Lymphoid Progenitor Differentiation Coating Material and the ImmunoCult Human CD3/CD28/CD2 T Cell Activator, was purchased from StemCell Technologies. The CTS OpTmizer T Cell Expansion SFM (no phenol red, bottle format), the Roswell Park Memorial Institute (RPMI) 1640 cell culture medium and the DMEM cell culture medium were purchased from Thermo Fisher Scientific. The CryoStor Cell Cryopreservation Media CS10 was purchased from MilliporeSigma.

α-Galactosylceramide (αGC, KRN7000) was purchased from Avanti Polar Lipids. Recombinant human IL-2, IL-3, IL-7, IL-15, IL-21, IFNγ, Flt3 ligand (Flt3L), stem cell factor (SCF) and thrombopoietin (TPO) were purchased from Peprotech. Ganciclovir, fetal bovine serum (FBS) and beta-mercaptoethanol (β-ME) were purchased from Sigma. Penicillin-streptomycin-glutamine (PSG), MEM non-essential amino acids, HEPES buffer solution and sodium pyruvate were purchased from Gibco. Normocin was purchased from Invivogen.

The homemade C10 medium was made of RPMI 1640 cell culture medium, supplemented with FBS (10% vol/vol), PSG (1% vol/vol), MEM non-essential amino acids (1% vol/vol), HEPES (10 mM), sodium pyruvate (1 mM), β-ME (50 mM) and normocin (100 mg ml−1). The homemade D10 medium was made of DMEM supplemented with FBS (10% vol/vol), PSG (1% vol/vol) and normocin (100 mg ml−1). The homemade R10 medium was made of RPMI supplemented with FBS (10% vol/vol), PSG (1% vol/vol) and normocin (100 mg ml−1).

Lentiviral vectors

Lentiviral vectors used in this study were all constructed from a parental lentivector pMNDW18,23,33. The 2A sequences derived from foot-and-mouth disease virus (F2A), porcine teschovirus-1 (P2A) and thosea asigna virus (T2A) were used to link the inserted genes to achieve coexpression.

The Lenti/iNKT vector was constructed by inserting into the pMNDW parental vector a synthetic bicistronic gene encoding human iNKT TCRα-F2A-TCRβ (refs. 18,23). The Lenti/iNKT-sr39TK vector was constructed by inserting a synthetic tricistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-sr39TK. The Lenti/iNKT-BCAR vector was constructed by inserting a synthetic tricistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-BCAR (BCAR indicates a BCMA-targeting CAR)24. The Lenti/iNKT-BCAR-IL15 vector was constructed by inserting a synthetic tetracistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-BCAR-T2A-IL15 (IL15 indicates the secreted form of human IL-15). The Lenti/iNKT-CAR19 vector was constructed by inserting a synthetic tricistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-CAR19 (CAR19 indicates a CD19-targeting CAR)25. The Lenti/iNKT-CAR19-IL15 vector was constructed by inserting a synthetic tetracistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-CAR19-T2A-IL15. The Lenti/iNKT-GD2.CAR vector was constructed by inserting a synthetic tricistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-GD2.CAR (GD2.CAR indicates a GD2-targeting CAR)26. The Lenti/iNKT-GD2.CAR-IL15 vector was constructed by inserting a synthetic tetracistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-GD2.CAR-T2A-IL15. The Lenti/iNKT-GPC3.CAR vector was constructed by inserting a synthetic tricistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-GPC3.CAR (GPC3CAR indicates a glypican-3-targeting CAR)27. The Lenti/iNKT-GPC3.CAR-IL15 vector was constructed by inserting a synthetic tetracistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-GPC3.CAR-T2A-IL15. The Lenti/iNKT-ECAR vector was constructed by inserting a synthetic tricistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-ECAR (ECAR indicates an epidermal growth factor receptor variant III-targeting CAR)28. The Lenti/iNKT-ECAR-IL15 vector was constructed by inserting a synthetic tetracistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-ECAR-T2A-IL15. The Lenti/iNKT-IL15-sr39TK vector was constructed by inserting a synthetic tetracistronic gene encoding human iNKT TCRα-F2A-TCRβ-P2A-IL15-T2A-sr39TK (sr39TK indicates an sr39TK suicide and positron emission tomography imaging reporter gene).

The Lenti/FlucGFP vector was constructed by inserting into the pMNDW a synthetic bicistronic gene encoding Fluc-P2A-EGFP (ref. 23). The Lenti/CD1d vector was constructed by inserting a synthetic gene encoding human CD1d (ref. 23). The Lenti/EGFRVIII vector was constructed by inserting a synthetic gene encoding human EGFRvIII. The Lenti/STAT1C-EGFP vector was constructed by inserting a synthetic bicistronic gene encoding STAT1C-P2A-EGFP (STAT1C indicates a human constitutively active STAT1, ref. 85). The Lenti/BCAR vector was constructed by inserting a synthetic gene encoding BCAR. The Lenti/BCAR-IL15 vector was constructed by inserting a synthetic bicistronic gene encoding BCAR-F2A-IL15. The Lenti/CAR19 vector was constructed by inserting a synthetic gene encoding CAR19. The Lenti/GD2.CAR vector was constructed by inserting a synthetic gene encoding GD2.CAR. The Lenti/GPC3.CAR vector was constructed by inserting a synthetic gene encoding GPC3.CAR. The Lenti/ECAR vector was constructed by inserting a synthetic gene encoding ECAR.

The synthetic gene fragments were obtained from GenScript and IDT. Lentiviruses were produced using human embryonic kidney (HEK) 293T cells (American Type Culture Collection (ATCC)), following a standard transfection protocol using the Trans-IT-Lenti Transfection Reagent (Mirus Bio) and a centrifugation concentration protocol using the Amicon Ultra Centrifugal Filter Units, according to the manufacturers’ instructions (MilliporeSigma).

Cell lines

Human MM cell line MM.1S, chronic myelogenous leukemia cell line K562, Burkitt’s lymphoma cell line Raji, acute lymphoblastic leukemia cell line NALM-6, melanoma cell line A375, glioblastoma cell line T98G and U87MG, hepatocellular carcinoma cell line HEP3B and HEK293T were purchased from the ATCC.

To make stable tumor cell lines overexpressing human CD1d or EGFRvIII, and/or FG dual reporters, the parental tumor cell lines were transduced with lentiviral vectors encoding the intended gene(s). Then 72 h after lentivector transduction, cells were subjected to flow cytometry sorting to isolate gene-engineered cells for making stable cell lines. Nine stable tumor cell lines were generated for this study, including MM-FG, MM-FG-CD1d, K562-FG, Raji-FG, Raji-FG-CD1d, NALM-6-FG, T98G-FG, U87MG-EGFRvIII-FG and Hep3B-FG cell lines. The KOMM-FG cell line was generated by knocking out the BCMA gene from the parental MM-FG cell line using CRISPR–Cas9. The single-guide RNA (sgRNA) targeting the BCMA gene (UAUUAAGCUCAGUCCCAAAC) was purchased from Synthego, and was introduced into MM-FG cells via electroporation using an Amaxa 4D Nucleofection X Unit (Lonza), according to the manufacturer’s instructions.

The artificial antigen-presenting cell (aAPC) was generated by engineering the K562 cell line to overexpress human CD83/CD86/4-1BBL costimulatory receptors86. The aAPC-BCMA, aAPC-CD19, aAPC-GD2, aAPC-GPC3 and aAPC-EGFRvIII cell lines were generated by further engineering the parental aAPC line to overexpress human BCMA, CD19, GD2, GPC3 and EGFRvIII, respectively.

Human CD34+ HSPCs, PBMCs and primary BM samples from patients with MM

Purified cord-blood-derived human CD34+ cells were purchased from the HemaCare. Healthy donor PBMCs were obtained from the UCLA/CFAR Virology Core Laboratory without identification information under federal and state regulations. Primary samples from patients with MM were collected at the Ronald Reagan UCLA Medical Center from consented patients through an IRB-approved protocol (IRB no. 21-001444) and processed.

Antibodies and flow cytometry

Fluorochrome-conjugated antibodies specific for human CD45 (Clone H130, cat. no. 304026, 1:500 dilution), TCRαβ (Clone I26, cat. no. 306716, 1:25 dilution), CD3 (Clone HIT3a, cat. no. 300329, 1:500 dilution), CD4 (Clone OKT4, cat. no. 317414, 1:400 dilution), CD8 (Clone SK1, cat. no. 344714, 1:500 dilution), CD45RO (Clone UCHL1, cat. no. 304216, 1:200 dilution), CD45RA (Clone HI100, cat. no. 304105, 1:5,000 dilution), CD161 (Clone HP-3G10, cat. no. 339928, 1:50 dilution), CD69 (Clone FN50, cat. no. 310909, 1:50 dilution), CD56 (Clone HCD56, cat. no. 362545, 1:10 dilution), CD1d (Clone 51.1, cat. no. 350308, 1:50 dilution), BCMA (19F2, cat. no. 357503, 1:50 dilution), CD14 (Clone HCD14, cat. no. 325608, 1:100 dilution), CD19 (Clone HIB19, cat. no. 363005, 1:100 dilution), CD11b (Clone ICRF44, cat. no. 301330, 1:500 dilution), CD15 (W6D3, cat. no. 323021, 1:500 dilution), CD112 (Clone TX31, cat. no. 337409, 1:200 dilution), CD155 (Clone SKII.4, cat. no. 337613, 1:200 dilution), MICA/MICB (Clone 6D4, cat. no. 320908, 1:50 dilution), Ganglioside GD2 (14G2a, cat. no. 357323, 1:50 dilution), NKG2D (Clone 1D11, cat. no. 320812, 1:50 dilution), DNAM-1 (Clone 11A8, cat. no. 338312, 1:50 dilution), CD158 (KIR2DL1/S1/S3/S5) (Clone HP-MA4, cat. no. 339510, 1:50 dilution), NKp30 (Clone P30-15, cat. no. 325207, 1:50 dilution), NKp44 (Clone P44-8, cat. no. 325107, 1:50 dilution), CD16 (Clone 3G8, cat. no. 302011, 1:50 dilution), NKG2A (Clone S19004C, cat. no. 375103, 1:50 dilution), NKG2C (Clone S19005E, cat. no. 375003, 1:50 dilution), CD62L (Clone P44-8, cat. no. 304813, 1:50 dilution), CD134 (Clone Ber-ACT35, cat. no. 350008, 1:50 dilution), LEF1 (Clone W17021C, cat. no. 621051, 1:50 dilution), CD8A (Clone C8/144B, cat. no. 372092, 1:500 dilution), CD8B (Clone QA20A40, cat. no. 387305, 1:500 dilution), IFNγ (Clone B27, cat. no. 506518, 1:50 dilution), Granzyme B (Clone QA16A02, cat. no. 372204, 1:4,000 dilution), Perforin (Clone dG9, cat. no. 308126, 1:50 dilution), TNFα (Clone Mab11, cat. no. 502912, 1:4,000 dilution), IL-2 (Clone MQ1-17H12, cat. no. 500341, 1:200 dilution), β2-microglobulin (B2M) (Clone 2M2, cat. no. 316312, 1:5,000 dilution), HLA-DR (Clone L243, cat. no. 307618, 1:250 dilution), and HLA-DR, double-positive, DQ (Clone Tü 39, cat. no. 361707, 1:250 dilution) were purchased from BioLegend. Fluorochrome-conjugated antibodies specific for mouse CD45 (Clone S18009F, cat. no. 157607, 1:5,000 dilution), GR1 (Clone RB6-8C5, cat. no. 108411, 1:1,000 dilution), CD1d (Clone 1B1, cat. no. 123521, 1:100 dilution), CD11b (Clone M1/70, cat. no. 101205, 1:5,000 dilution), Sca1 (Clone D7, cat. no. 108111, 1:100 dilution), Flt3 (Clone A2F10, cat. no. 135305, 1:100 dilution), SLAM (Clone TC15-12F12.2, cat. no. 115913, 1:50 dilution), c-Kit (Clone 2B8, cat. no. 105825, 1:50 dilution) were purchased from BioLegend. In our study, note the use of antibodies with identical clones but differing conjugated fluorochromes, with one typical antibody listed herein. Fluorochrome-conjugated antibody specific for human Glypican-3 (GPC3; Clone 024, cat. no. ab275695, 1:200 dilution) was purchased from Abcam. Fluorochrome-conjugated antibodies specific for human CD34 (Clone 581, cat. no. 555822, 1:100 dilution) and human iNKT TCR Vɑ24-Jβ18 (Clone 6B11, cat. no. 552825, 1:10 dilution) were purchased from BD Biosciences. Fluorochrome-conjugated antibody specific for human iNKT TCR Vβ11 (Clone C21, cat. no. A66905, 1:50 dilution) was purchased from Beckman-Coulter. Fluorochrome-conjugated antibodies specific for human ULBP-1 (Clone 170818, cat. no. FAB1380P, 1:50 dilution) and ULBP-2,5,6 (Clone 165903, cat. no. FAB1298A5, 1:50 dilution) were purchased from R&D Systems. A goat antimouse IgG F(ab’)2 secondary antibody (cat. no. 31803, 1:50 dilution) was purchased from Thermo Fisher. Fixable Viability Dye eFluor506 (e506, cat. no. 65-0866-14, 1:500 dilution) was purchased from Affymetrix eBioscience; mouse Fc Block (antimouse CD16/32, cat. no. 553142, 1:50 dilution) was purchased from BD Biosciences and human Fc Receptor Blocking Solution (TrueStain FcX, cat. no. 422302, 1:100 dilution) was purchased from BioLegend.

All flow cytometry staining was performed following standard protocols, as well as specific instructions provided by the manufacturer of a particular antibody. Stained cells were analyzed using a MACSQuant Analyzer 10 flow cytometer (Miltenyi Biotech), following the manufacturer’s instructions. FlowJo software v.9 (BD Biosciences) was used for data analysis.

Enzyme-linked immunosorbent cytokine assays (ELISAs)

Supernatants from cell culture assays were collected and assayed to quantify human IFNγ, TNFα, IL-2, and IL-4. The capture and biotinylated pairs for detecting cytokines were purchased from BD Biosciences. The streptavidin–HRP conjugate was purchased from Invitrogen. Human cytokine standards were purchased from eBioscience. Tetramethylbenzidine (TMB) substrate was purchased from KPL. Human IL-15 was quantified using a Human IL-15 Quantikine ELISA Kit (R&D Systems), following the manufacturer’s instructions. Human IL-17a was quantified using a Human IL-17A ELISA MAX Deluxe Kit (BioLegend), following the manufacturer’s instructions. Mouse IL-6 was quantified with paired purified anti-mouse IL-6 antibody and biotin anti-mouse IL-6 antibody (BioLegend). Mouse SAA-3 was quantified using a Mouse SAA-3 ELISA Kit (MilliporeSigma), per the manufacturer’s instructions. The samples were analyzed for absorbance at 450 nm using an Infinite M1000 microplate reader (Tecan).

Generation of allogeneic HSPC-engineered NKT (AlloNKT) cells and their CAR/IL15-armed derivatives (denoted as Allo/15CAR-NKT cells)

AlloNKT and Allo/15CAR-NKT cells were generated by differentiating gene-engineered cord-blood CD34+ HSPCs in a five-stage Ex Vivo HSPC-Derived NKT Cell Culture. AlloNKT cells were differentiated from HSPCs engineered to overexpress a transgenic human iNKT TCR, while Allo/15CAR-NKT cells were differentiated from HSPCs engineered to overexpress a human transgenic iNKT TCR, together with a selected CAR and/or the secreted form of human IL-15.

At stage 0, 1 × 104 frozen–thawed human CD34+ HSPCs were revived and cultured in 300 µl of X-VIVO 15 Serum-Free Hematopoietic Stem Cell Medium supplemented with 50 ng ml−1 Flt3L, 50 ng ml−1 stem cell factor, 50 ng ml−1 thrombopoietin and 20 ng ml−1 IL-3 in non-tissue culture treated 24-well plate for 24 h, then transduced with Lenti/iNKT-(CAR)-(IL15) viruses for another 24 h following an established protocol18,23. Briefly, concentrated lentivirus supernatant was mixed with 1:100 Poloxamer Synperonic F108 and 1:1,000 Prostaglandin E2 (PGE2; CAYMAN), and then gently added to the HSPCs culture.

At stage 1, gene-engineered HSPCs collected from stage 0 were cultured in the StemSpan SFEM II Medium supplemented with StemSpan Lymphoid Progenitor Expansion Supplement for 2 weeks. CELLSTAR 24-well Cell Culture Non-treated Multiwell Plates (VWR) were used. The plates were coated with 500 µl per well StemSpan Lymphoid Differentiation Coating Material for 2 h at room temperature or alternatively, overnight at 4 °C. Transduced CD34+ HSPCs were suspended at 2 × 104 cells per ml and 500 µl of cell suspension was added into each precoated well. Twice per week, half of the medium from each well was removed and replaced with fresh medium.

At stage 2, cells collected from the stage 1 were cultured in the StemSpan SFEM II Medium supplemented with StemSpan Lymphoid Progenitor Maturation Supplement for 1 week. Non-Treated Falcon Polystyrene six-well Microplates (Thermo Fisher Scientific) were coated with 1 ml per well of StemSpan Lymphoid Differentiation Coating Material. The stage 1 cells were collected and resuspended at 1 × 105 cells per ml; 2 ml of cell suspension was added into each precoated well. Cells were passaged 1–2 times per week to maintain a cell density at 0.5–1 × 106 cells per ml; fresh medium was added at every passage.

At stage 3, cells collected from the stage 2 were cultured in the StemSpan SFEM II Medium supplemented with StemSpan Lymphoid Progenitor Maturation Supplement, CD3/CD28/CD2 T Cell Activator and 20 ng ml−1 human recombinant IL-15 for 1 week. Cells were resuspended at 5 × 105 cells per ml; 2 ml cell suspension was added into Non-Treated Falcon Polystyrene six-well Microplates (Thermo Fisher Scientific) precoated with 1 ml per well of StemSpan Lymphoid Differentiation Coating Material. Cells were passaged 2–3 times per week to maintain a cell density at 0.5–1 × 106 cells per ml; fresh medium was added at every passage.

At stage 4, cells collected from the stage 3, now mature Allo/15(CAR)-NKT cells or their derivatives, were expanded using various expansion approaches: (1) an αCD3/αCD28 expansion approach, (2) an αGC–PBMC expansion approach or (3) an aAPC expansion approach. The expansion stage lasted for 2 weeks. At stage 4, cells could be cultured in 150 mm cell culture dishes (Thermo Fisher Scientific) or G-Rex 6M Well Plates (Wilson Wolf). The expansion can happen in a feeder-free, serum-free CTS OpTmizer T Cell Expansion SFM (Thermo Fisher Scientific) or a homemade C10 medium. The resulting Allo/15(CAR)-NKT or derivative cell products were aliquoted and cryopreserved in CryoStor Cell Cryopreservation Media CS10 using a Thermo Scientific CryoMed Controlled-Rate Freezer 7450 (Thermo Scientific) for future use, following the manufacturer’s instructions.

(1)

The αCD3/αCD28 antibody expansion approach used 150 mm cell culture dishes (Thermo Fisher Scientific), which were coated with 1 µg ml−1 (500 µl per well) of Ultra-LEAF Purified Anti-Human CD3 Antibody (Clone OKT3; BioLegend) for 2 h at room temperature or, alternatively, overnight at 4 °C. Mature Allo/15(CAR)-NKT cells or their derivatives collected from the stage 3 culture were resuspended in the expansion medium supplemented with 10 ng ml−1 IL-7, 10 ng ml−1 IL-15 and 1 μg ml−1 Ultra-LEAF Purified Anti-Human CD28 antibody (Clone CD28.2; BioLegend) at 5 × 105 cells per ml; 30 ml cell suspension was added into each plate. After 3 days of culture, cells were collected and resuspended in fresh expansion medium supplemented with 10 ng ml−1 IL-7 and IL-15, at 0.5–1 × 106 cells per ml. Cells were passaged 2–3 times per week to maintain a cell density at 0.5–1 × 106 cells per ml; fresh medium was added at every passage. As the cell population reaches a high number during the later stages, these cells can be transferred and cultured in G-Rex 6M Well Plates (Wilson Wolf).

(2)

The αGC–PBMC expansion approach. Healthy donor PBMCs were loaded with α-Galactosylceramide (αGC; Avanti Polar Lipids) at 5 μg ml−1 in C10 medium for 1 h following a previously established protocol23. The resulting αGC-loaded PBMCs (αGC–PBMCs) were then irradiated at 6,000 rads using a Rad Source RS-2000 X-Ray Irradiator (Rad Source Technologies). Mature Allo/15CAR-NKT cells and derivatives collected from the stage 3 culture were mixed with the irradiated αGC–PBMCs at a 1:5 ratio, resuspended in expansion medium supplemented with 10 ng ml−1 IL-7 and IL-15 at 0.5–1 × 106 cells per ml and seeded into the 150 mm cell culture dishes (Thermo Fisher Scientific) at 30 ml per plate. Cells were passaged 2–3 times per week to maintain a cell density at 0.5–1 × 106 cells per ml; fresh medium was added at every passage. As the cell population reaches a high number during the later stages, these cells can be transferred and cultured in G-Rex 6M Well Plates (Wilson Wolf).

(3)

The aAPC expansion approach. aAPCs were irradiated at 10,000 rads using a Rad Source RS-2000 X-Ray Irradiator (Rad Source Technologies). Mature Allo/15CAR-NKT cells and derivatives collected from the stage 3 culture were mixed with the irradiated aAPCs at a 1:1 ratio, resuspended in expansion medium supplemented with 10 ng ml−1 IL-7 and IL-15 at 0.5–1 × 106 cells per ml, and seeded into the 150 mm cell culture dishes (Thermo Fisher Scientific) at 30 ml per plate. Cells were passaged 2–3 times per week to maintain a cell density at 0.5–1 × 106 cells per ml; fresh medium was added at every passage. As the cell population reaches a high number, cells can be transferred to and cultured in G-Rex 6M Well Plates (Wilson Wolf).

Generation of PBMC-derived conventional αβT, NKT and NK cells

Healthy donor PBMCs were used to generate the PBMC-derived conventional αβ T, NKT and NK cells (denoted as PBMC-Tc, PBMC-NKT and PBMC-NK cells, respectively).

To generate PBMC-Tc cells, PBMCs were stimulated with Dynabeads Human T-Activator CD3/CD28 (Thermo Fisher Scientific) according to the manufacturer’s instructions, followed by culturing in the C10 medium supplemented with 20 ng ml−1 IL-2 for 2–3 weeks.

To generate PBMC-NKT cells, PBMCs were sorted with magnetic-activated cell sorting (MACS) via Anti-iNKT Microbeads (Miltenyi Biotech) labeling to enrich NKT cells, following the manufacturer’s instructions. The enriched NKT cells were mixed with donor-matched irradiated αGC–PBMCs at a ratio of 1:1, followed by culturing in C10 medium supplemented with 10 ng ml−1 IL-7 and IL-15 for 2–3 weeks. If needed, the resulting cultured cells could be further purified using fluorescence-activated cell sorting (FACS) via human NKT TCR antibody (Clone 6B11; BD Biosciences) staining.

To generate PBMC-NK cells, PBMCs were sorted with FACS using a FACSAria III Sorter (BD Biosciences) via human CD56 antibody (Clone HCD56; BioLegend) labeling or with MACS using a Human NK Cell Isolation Kit (Miltenyi Biotech), following the manufacturers’ instructions.

Generation of CAR-engineered conventional αβ T (CAR-T) cells

Non-treated tissue culture 24-well plates (Corning) were coated with Ultra-LEAF Purified Anti-Human CD3 Antibody (Clone OKT3; BioLegend) at 1 µg ml−1 (500 µl per well), at room temperature for 2 h or at 4 °C overnight. Healthy donor PBMCs were resuspended in the C10 medium supplemented with 1 µg ml−1 Ultra-LEAF Purified Anti-Human CD28 Antibody (Clone CD28.2, BioLegend) and 30 ng ml−1 IL-2, followed by seeding in the precoated plates at 1 × 106 cells per ml (1 ml per well). On day 2, cells were transduced with lentiviruses for 24 h. The resulting CAR-T cells were expanded for about 2 weeks in C10 medium and cryopreserved for future use.

Generation of PBMC-derived CAR-engineered NKT (PBMCCAR-NKT) cells

Healthy donor PBMCs were sorted with MACS via Anti-iNKT Microbeads (Miltenyi Biotech) labeling to enrich NKT cells, following the manufacturer’s instructions. The enriched NKT cells were mixed with donor-matched irradiated αGC–PBMCs at a ratio of 1:1, followed by culturing in C10 medium supplemented with 10 ng ml−1 IL-7 and IL-15. On day 3, NKT cells were transduced with Lenti/BCAR-IL15 viruses for 24 h. The resulting CAR-NKT cells were expanded for about 2 weeks in C10 medium supplemented with 10 ng ml−1 IL-7 and IL-15 and cryopreserved for future use.

In vitro tumor cell killing assay

Tumor cells (1 × 104 cells per well) were cocultured with therapeutic cells (at ratios indicated in figure legends) in Corning 96-well clear bottom black plates for 8–24 h, in C10 medium with or without the addition of αGC (100 ng ml−1). At the end of culture, live tumor cells were quantified by adding d-luciferin (150 μg ml−1; Caliper Life Science) to cell cultures and reading out luciferase activities using an Infinite M1000 microplate reader (Tecan). In some experiments, 10 μg ml−1 LEAF purified antihuman NKG2D (Clone 1D11, BioLegend), antihuman DNAM-1 antibody (Clone 11A8, BioLegend) or LEAF purified mouse lgG2bk isotype control antibody (Clone MG2B-57, BioLegend) was added to cocultures, to study the NK activating receptor-mediated tumor cell killing mechanism.

In vitro assays using samples from patients with MM

Primary BM samples from patients with MM were collected and subsequently diluted in PBS and subjected to density gradient centrifugation using Ficoll-Paque (Thermo Fisher Scientific) to obtain mononuclear cells following the manufacturer’s instructions. The resulting cells were cryopreserved for future use.

In one assay, the primary samples from patients with MM were analyzed for tumor cell phenotype and the TME composition using flow cytometry. Tumor cells were sorted using a Human Tumor Cell Isolation Kit (Miltenyi Biotec) and/or identified as CD45−CD31−FAP (fibroblast activation protein)− cells, T cells were identified as CD45+CD3+ cells, B cells were identified as CD45+CD19+ cells, NK cells were identified as CD45+CD56+ cells, monocytes and macrophages were identified as CD45+CD11b+CD14+ cells, granulocytes were identified as CD45+CD11b+CD15+ cells and granulocyte-like MDSCs were identified as CD45+CD15+HLA-DR+ cells. Surface expression of BCMA, CD1d and NK ligands on tumor or/and immune cells were also analyzed using flow cytometry.

In another assay, the primary samples from patients with MM were used to study tumor cell killing by Allo15BCAR-NKT cells. Tumor cells were presorted using a Human Tumor Cell Isolation Kit (Miltenyi Biotec), followed by coculturing with various therapeutic cells (therapeutic cell:tumor cell ratio 1:1) in C10 medium in Corning 96-well Round Bottom Cell Culture plates for 24 h. At the end of culture, cells were collected and live MM tumor cells (identified as CD45−CD3−6B11−) were analyzed using flow cytometry.

In another assay, the primary samples from patients with MM were used to study the TME targeting by Allo15BCAR-NKT cells. Patient samples were directly cocultured with Allo15BCAR-NKT cells (therapeutic cell:tumor cell ratio 1:1) in C10 medium in Corning 96-well Round Bottom Cell Culture plates for 24 h. At the end of culture, cells were collected and the TME targeting of Allo15BCAR-NKT cells was assessed using flow cytometry by quantifying live human monocytes and macrophages (identified as 6B11−CD45hiCD14+CD11b+), MDSCs (identified as 6B11−CD45medCD15+CD11b+HLA-DR+), CD4 T cells (identified as 6B11−CD45hiCD3+CD4+), CD8 T cells (identified as 6B11−CD45hiCD3+CD8+), B cells (identified as 6B11−CD45hiCD3−CD19+), granulocytes (identified as 6B11−CD45medCD15+CD11b+HLA-DR−) and NK cells (identified as 6B11−CD45hiCD3−CD56+).

In vitro MLR assay for studying GvH response

PBMCs of multiple random healthy donors were irradiated at 2,500 rads and used as stimulators to study the GvH response of Allo15BCAR-NKT cells as responders. BCAR-T cells were included as a responder control. Stimulators (5 × 105 cells per well) and responders (2 × 104 cells per well) were cocultured in 96-well round-bottom plates in C10 medium for 4 days; the cell culture supernatants were then collected to measure IFNγ production using enzyme-linked immunosorbent assay (ELISA).

In vitro MLR assay for studying T cell-mediated allorejection

PBMCs of multiple healthy donors were used as responders to study the T cell-mediated allorejection of Allo15BCAR-NKT cells as stimulators (irradiated at 2,500 rads). PBMC-derived BCAR-T cells were included as a stimulator control. Stimulators (5 × 105 cells per well) and responders (2 × 104 cells per well) were cocultured in 96-well round-bottom plates in C10 medium for 4 days; the cell culture supernatants were then collected to measure IFNγ production using ELISA.

In vitro MLR assay for studying NK cell-mediated allorejection

PBMC-derived NK cells obtained from multiple healthy donors were employed to investigate the NK cell-mediated allorejection of Allo15BCAR-NKT cells. Conventional BCAR-T cells were included as an allogeneic subject control. PBMC-NK cells (2 × 104 cells per well) and the corresponding allogeneic subject cells (2 × 104 cells per well) were cocultured in 96-well round-bottom plates with C10 medium for 24 h. Subsequently, the cell cultures were collected to quantify live cells via flow cytometry.

In vivo BLI

Bioluminescence live animal imaging (BLI) was performed using a Spectral Advanced Molecular Imaging (AMI) HTX imaging system (Spectral instrument Imaging). Live animal images were acquired 5 min after intraperitoneal (i.p.) injection of d-luciferin for total body bioluminescence. To monitor the signal of tumor cells, 1 mg per mouse of d-luciferin was injected. To monitor the signal of therapeutic cells, 3 mg per mouse of d-luciferin was injected. Imaging data were analyzed using AURA imaging software (Spectral Instrument Imaging, v.3.2.0).

In vivo antitumor efficacy study of Allo/15BCAR-NKT cells: human MM xenograft NSG mouse model

Experimental design is shown in Fig. 3a. Briefly, on Day 0, NSG mice received intravenously (i.v.) inoculation of MM-FG human MM cells (1 × 106 cells per mouse). On day 10, the experimental mice received i.v. injection of vehicle (100 μl PBS per mouse), Allo/15BCAR-NKT cells (10 × 106 CAR+ cells in 100 μl PBS per mouse), or control BCAR-T cells (10 × 106 CAR+ cells in 100 μl PBS per mouse). Over the experiment, mice were monitored for survival and their tumor loads were measured using BLI.

In vivo antitumor efficacy study of Allo15CAR19-NKT cells: human B cell leukemia xenograft NSG mouse model

Experimental design is shown in Supplementary Fig. 15h. Briefly, on day 0, NSG mice received i.v. inoculation of Nalm6-FG human B cell leukemia cells (1 × 106 cells per mouse). On day 4, the experimental mice received an i.v. injection of vehicle (100 μl PBS per mouse), Allo15CAR19-NKT cells (5 × 106 CAR+ cells in 100 μl PBS per mouse) or control CAR19-T cells (10 × 106 CAR+ cells in 100 μl PBS per mouse). Over the experiment, mice were monitored for survival and their tumor loads were measured using BLI.

In vivo PK–PD study of Allo/15BCAR-NKT/FG cells: human MM xenograft NSG mouse model

Experimental design is shown in Fig. 3f. Briefly, on day 0, NSG mice received i.v. inoculation of MM. 1S cells (1 × 106 cells per mouse; denoted as MM). On day 10, the experimental mice received i.v. injection of Allo/15BCAR-NKT/FG cells (10 × 106 CAR+ cells in 100 μl of PBS per mouse) or control BCAR-T/FG cells (10 × 106 CAR+ cells in 100 μl PBS per mouse). Over the experiment, mice were monitored for survival and their therapeutic cells were measured using BLI. Note in this study, therapeutic immune cells, but not the tumor cells, were labeled with FG.

In vivo CRS study

Experimental design is shown in Fig. 5p. Briefly, on day 0, NSG mice received i.v. inoculation of MM-FG cells (5 × 106 cells per mouse). On day 10, the experimental mice received i.v. injection of vehicle (100 μl PBS per mouse), Allo15BCAR-NKT cells (10 × 106 CAR+ cells in 100 μl PBS per mouse) or control BCAR-T cells (10 × 106 CAR+ cells in 100 μl PBS per mouse). On days 11 and 13, blood samples were collected from the experimental mice, and their serum IL-6 and SAA-3 were measured using ELISA. A Mouse SAA-3 ELISA Kit (Millipore Sigma) was used to measure SAA-3, following the manufacturer’s instructions.

Single-cell TCR sequencing

PBMC-Tc, PBMC-NKT, AlloNKT and Allo/15BCAR-NKT cells were sorted using a FACSAria III Sorter (BD Biosciences). Sorted cells were immediately delivered to the UCLA Technology Center for Genomics and Bioinformatics (TCGB) Core to perform single-cell TCR sequencing using a 10X Genomics Chromium Controller Single Cell Sequencing System (10X Genomics), following the manufacturer’s instructions and the TCGB Core’s standard protocols. Libraries were constructed using an Illumina TruSeq RNA Sample Prep Kit (Illumina) and sequenced with 150 bp paired-end reads (5,000 reads per cell) on an Illumina NovaSeq 6000 sequencer. The reads were mapped to the human TCR reference genome (hg38) using Cell Ranger VDJ (10X Genomics). The frequencies of the α or β chain recombination were plotted.

Bulk RNA-seq

A total of 24 cell samples were analyzed, including three AlloNKT, three AlloBCAR-NKT, three Allo15BCAR-NKT, two AlloCAR19-NKT, three PBMC-NKT, eight PBMC-Tc and two PBMC-NK cell samples; the numbers indicate different donors. Note that Allo/15(CAR)-NKT cells displayed a CD4−CD8+/− phenotype, therefore the CD4− populations of PBMC-NKT and PBMC-Tc cells were used in this study.

Cell samples were sorted using a FACSAria III Sorter (BD Biosciences). Total RNAs were isolated from each cell sample using a miRNeasy Mini Kit (Qiagen) and delivered to the UCLA TCGB Core to perform bulk RNA-seq using an Illumina HiSeq3000, following the manufacturer’s instructions and the TCGB Core’s standard protocols. Complementary DNAs were synthesized using an iScript cDNA Synthesis Kit (BioRad). Libraries were constructed using an Illumina TruSeq Stranded Total RNA Sample Prep kit and sequenced with 50 bp single-end reads (targeting 20 × 106 reads per sample) on an Illumina HiSeq3000. The raw sequencing data underwent quality control and adapter trimming using fastp (v.0.23.2), and trimmed reads were mapped to the human genome (hg38) using with STAR v.2.7.9a with default parameters. The read counts for each gene were obtained using featureCounts from Subread package (v.2.0.3). Sequencing depth normalized counts (in counts per million) were obtained using edgeR (v.3.38.4), and the log transformation with psuedocount 1 was used for principal component analysis.

scRNA-seq

In one study, scRNA-seq was used to investigate the lineage commitment of Allo/15BCAR-NKT cells during their in vitro differentiation from gene-engineered HSPCs. Cord-blood CD34+ HSPCs of the same donor were transduced with either a Lenti/iNKT-BCAR or Lenti/iNKT-BCAR-IL15 lentivector, followed by differentiating into AlloBCAR-NKT or Allo15BCAR-NKT cell product, respectively, in the Ex Vivo HSPC-Derived CAR-NKT Cell Culture. At days 7, 14, 21, 28 and 42, cell cultures were collected for scRNA-seq.

In another study, scRNA-seq was used to examine the in vivo gene profiles of therapeutic cells, tumor cells and mouse immune cells in an MM-FG human MM xenograft NSG mouse model as shown in Fig. 4a. The three types of therapeutic cell (Allo15BCAR-NKT, AlloBCAR-NKT, and BCAR-T cells) were collected at three time points (days 0, 28 and 35). Day 0 samples were collected before infusion, day 28 samples were collected from the BM tumor sites of the experimental mice and day 35 samples were generated by stimulating day 28 samples in vitro with BCMA-expressing aAPCs for 1 week. The tumor cells (MM-FG) and mouse immune cells (mouse CD45+ cells) were collected on day 28. Cells isolated from ten mice of each experimental group were combined for scRNA-seq.

Freshly collected samples were immediately delivered to the UCLA TCGB Core for library construction and scRNA-seq. Cells were quantified using a Cell Countess II automated cell counter (Invitrogen/Thermo Fisher Scientific). A total of 10,000 cells from each experimental group were loaded on the Chromium platform (10X Genomics), and libraries were constructed using the Chromium Next GEM Single Cell 3′ Kit v3.1 and the Chromium Next GEM Chip G Single Cell Kit (10X Genomics), according to the manufacturer’s instructions. Library quality was assessed using the D1000 ScreenTape on a 4200 TapeStation System (Agilent Technologies). Libraries were sequenced on an Illumina NovaSeq using the NovaSeq S4 Reagent Kit (100 cycles; Illumina).

For cell clustering and annotation, the merged digital expression matrix generated by Cell Ranger was analyzed using an R package Seurat (v.4.0.0) following the guidelines. Briefly, after filtering the low-quality cells, the expression matrix was normalized using NormalizeData function, followed by selecting variable features across datasets using FindVariableFeatures and SelectIntegrationFeatures functions. To correct the batch effect, FindIntegrrationAnchors and IntegrateData functions were used based on the selected feature genes. The corrected dataset was subjected to standard Seurat workflow for dimension reduction and clustering. In this study, clusters of therapeutic cells were manually merged and annotated based on gene signatures reported from Human Protein Atlas (proteinatlas.org) and previous studies38,39,40,41,42,43,44,45, and clusters of mouse immune cells were merged and annotated based on the immune lineage markers. AddModuleScore was used to calculate module scores of each list of gene signatures, and FeaturePlot function was used to visualize the expression of each signature in the UMAP plots.

For gene set enrichment analysis (GSEA), clusterProfiler packages87,88 were used to calculate the enrichment scores of each cluster in the signature gene list.

For RNA-velocity analysis, the .LOOM files containing spliced and unspliced expression matrices were generated for each sample. The further analysis was conducted using the Velocyto.R-package (v.0.6)89. After loading .LOOM file information through the ReadVelocity function, databases were merged and the RunVelocity function was executed to obtain the velocity vectors. Finally, the velocities were projected into a lower-dimensional embedding using the velocity_graph function and visualized on the UMAP embedding in each intended cell cluster using the show.velocity.on.embedding.cor function. All velocyto functions were used with default parameters.

Methylation sequencing

Genomic DNA was isolated from experimental samples using a QIAGEN DNeasy Blood & Tissue kit, then sonicated using a Covaris M220 Focused-ultrasonicator, following the manufacturers’ instructions. DNA fragments of around 250 bp were enriched using the Ampure XP beads (Beckman-Coulter), then subjected to DNA library preparation using an NEBNext Ultra II DNA library prep Kit (cat. no. E7645) following the manufacturers’ instructions. The DNA libraries were then subjected to sequencing on Illumina NovaSeq sequencer with 2 × 150 bp configuration (Azenta). The raw bisulfite sequencing reads were trimmed by cutadapt to remove sequencing adapters. The trimmed reads were then aligned to hg19 reference genome by Bismark90. Then duplicated reads from PCR amplification were identified and removed by Bismark. The deduplicated reads were then sorted and indexed using Samtools. After that, the methylated and unmethylated cytosines were counted at every CpG site by Bismark. The methylation at a gene promoter region was quantified as the beta value, that is, the ratio between the number of methylated cytosines and the total number of cytosines mapped to the region. The promoter region of a gene was identified by GeneHancer with the highest confidence score. The beta values were then used for heatmap visualization.

Histology

Tissues (that is, heart, liver and lung) were collected from experimental mice, fixed in 10% Neutral Buffered Formalin for up to 36 h and embedded in paraffin for sectioning (5 μm thickness). Tissue sections were prepared and stained with hematoxylin and eosin by the UCLA Translational Pathology Core Laboratory, following the Core’s standard protocols. Stained sections were imaged using an Olympus BX51 upright microscope equipped with an Optronics Macrofire CCD camera (AU Optronics). The images were analyzed using Optronics PictureFrame software (AU Optronics).

Western blot

Western blot was used to analyze the IFNγ signaling events in Allo/15BCAR-NKT cells. Conventional BCAR-T cells and quiescent T cells prepared from the same healthy donor PBMCs were included as controls. Quiescent T cells were sorted with MACS from PBMCs using mixed antihuman CD4 and CD8 magnetic beads (Miltenyi Biotec) to avoid the potential CD3 stimulation, following the manufacturer’s instructions.

Cells were stimulated with IFNγ (10 ng ml−1) for 15 min (for blotting p-STAT1/STAT1), 18 h (for blotting IRF-1) or 48 h (for blotting CIITA/SP1). Total proteins were extracted using a RIPA lysis buffer (Thermo Fisher Scientific) containing 20 mM HEPES (pH 7.6), 150 mM NaCl, 1 mM EDTA, 1% Tritonx-100 and protease–phosphatase inhibitor cocktail (Cell Signaling Technology). Protein concentration was measured using a Bicinchoninic Acid Assay Kit (Thermo Fisher Scientific). Equal amounts of total protein were resolved on a 4–15% Mini-PROTEAN TGX Precast Protein Gel (BioRad) and then transferred to a polyvinylidene difluoride membrane by electrophoresis. The following antibodies were used to blot for the proteins of interest: antihuman CIITA (Invitrogen, cat. no. PA5-21031, 1:1,000 dilution), antihuman p-STAT1(Y701) (Clone 58D6, Cell Signaling Technology, CST, cat. no. 9167, 1:1,000 dilution), antihuman STAT1 (Clone D1K9Y, CST, cat. no. 14994, 1:1,000 dilution), antihuman IRF-1 (Clone D5E4, CST, cat. no. 8478, 1:1,000 dilution), antihuman SP1 (Clone D4C3, CST, cat. no. 9389, 1:1,000 dilution) and secondary antirabbit IgG (CST, cat. no. 7074, 1:1,000 dilution). β-Actin (Clone D6A8, CST, cat. no. 8457, 1:3,000 dilution) and glyceraldehyde 3-phosphate dehydrogenase (Clone D16H11, CST, cat. no. 5174, 1:3,000 dilution) were used as internal controls. Signals were visualized using a ChemiDoc Imaging Systems (Bio-Rad). The data were analyzed using ImageJ (v.1.53s).

Generation and analysis of Allo15BCAR-NKT cells overexpressing a constitutively active STAT1 (denoted as Allo15BCAR-NKT/STAT1C cells)

Allo15BCAR-NKT/STAT1C cells were generated by further engineering the Allo15BCAR-NKT cells to overexpress a constitutively active human STAT1 (STAT1C)85. The Lenti/STAT1C-EGFP vector or a mock control Lenti/Fluc-EGFP vector was added into the Allo15BCAR-NKT cell culture during stage 4 (on day 3 of stage 4), followed by the continuation and completion of stage 4 culture. The resulting Allo15BCAR-NKT/STAT1C cells, as well as their mock control Allo15BCAR-NKT/FG cells, were then analyzed using flow cytometry. The overexpression of transgenic STAT1C was measured by EGFP coexpression in Allo15BCAR-NKT/STAT1C cells. The rescue effect of STAT1C overexpression in EGFP+ Allo15BCAR-NKT/STAT1C cells was assessed by comparing these cells with the control EGFP+ Allo15BCAR-NKT/FG cells for cell surface expression of HLA-I/II molecules and NK ligands.

Statistics

Graphpad Prism v.8 software (Graphpad) was used for statistical data analysis. Student’s two-tailed t-test was used for pairwise comparisons. Ordinary one-way analysis of variance (ANOVA) followed by Tukey’s or Dunnett’s multiple comparisons test was used for multiple comparisons. A log rank (Mantel–Cox) test adjusted for multiple comparisons was used for Meier survival curves analysis. Data are presented as the mean ± s.e.m., unless otherwise indicated. In all figures and figure legends, n represents the number of samples or animals used in the indicated experiments. A P value of less than 0.05 was considered significant and NS denotes not significant.

Reporting summary

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.