Cell culture

Mouse cerebral arterial endothelial cells (mCAECs, Cat NO.: CP-M100) and BV2 retroviral-immortalized microglia (CL-0493A) were obtained from Procell Life Science and Technology Co. Ltd. (Wuhan, China). BV-2 cells were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS), 2 mM l-glutamine, 100 mg/mL streptomycin, and 100 U/mL penicillin. The mCAECs were cultured in a specific culture medium provided by Procell Life Science & Technology Co., Ltd. All the cells were cultured in a CO2 incubator at 37 °C, 5% CO2, and saturated humidity.

Construction of NEAT1 overexpression plasmid

The full-length coding sequence of mouse NEAT1 (NR_003513) was amplified using NEAT1-F (5′-cggggtaccGTAGGAGTTAGTGACAAGGAGGGCTCGCTCTT-3′, Kpn I) and NEAT1-R (5′-ataagaatgcggccgcTTTTTTTCTAAGAAGCTTCAATCTCAAAC-3′, Not I) primers. The PCR amplification products were digested and ligated into the pcDNA3.1 + vector. After digestion and sequencing verification, the NEAT1 overexpression plasmid was successfully obtained and named pcDNA-NEAT1.

BV-2 cell group

To investigate the role and mechanism of NEAT1, BV-2 cells were classified into six groups. The first group, referred to as the blank group, consisted of BV-2 cells cultured under normal conditions without intervention. The second group, named the empty vector group, involved the transfection of BV-2 cells with the empty vector pcDNA3.1+. The third group, designated the pcDNA-NEAT1 group, was transfected with pcDNA-NEAT. In the fourth group, BV-2 cells were exposed to lipopolysaccharide (LPS; 1 μg/mL). The fifth group included BV-2 cells treated with 1 μg/mL LPS and simultaneously transfected with a negative control siRNA (siNC), labeled as the LPS + siNC group. The sixth group comprised BV-2 cells treated with 1 μg/mL LPS and transfected with siRNA targeting NEAT1 (siNEAT1), denoted as the LPS + siNEAT1 group.

To confirm whether NEAT1 regulates the angiogenic ability of mCAECs via the AMP-activated protein kinase (AMPK) pathway, BV-2 cells were classified into three groups. The first group, referred to as the empty vector + dimethyl sulfoxide (DMSO) group, consisted of BV-2 cells transfected with pcDNA3.1 + empty vector and treated with DMSO. In the second group, named the pcDNA-NEAT1 + DMSO group, BV-2 cells were transfected with pcDNA-NEAT1 and treated with DMSO. The third group, designated as the pcDNA-NEAT1 + 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) group, entailed the transfection of BV-2 cells with pcDNA-NEAT1 and treatment with the AMPK activator AICAR.

All groups were transfected using Lipofectamine® 3000 (Invitrogen, Carlsbad, CA, USA). The transfection procedure adhered strictly to the manufacturer’s instructions.

Fluorescence quantitative reverse transcription polymerase chain reaction (PCR)

Total RNA from the six groups of BV-2 cells was isolated using TRIzol reagent (Invitrogen). After quality assessment, total RNA was reverse-transcribed into cDNA. Next, a 20-µL PCR reaction mixture was prepared using cDNA as the template, following the instructions provided by YEASEN Biotechnology Co., Ltd. (Shanghai) for the SYBR Green qPCR Mix. The prepared PCR mixture was loaded into an ABI PRISM® 7500 Sequence Detection System (Foster City, CA, USA) for quantitative PCR analysis. The relative expression levels of the target gene NEAT1 were determined using the 2^(-Delta Delta C(T)) method. The primer sequences (5′–3′) for NEAT1 were as follows: GGGAAAGCTGTTGGGTTGTA (forward) and GCCTTCCCACTGTTAAACCA (reverse). The primer sequences (5′–3′) for the reference gene glyceraldehyde 3-phosphate dehydrogenase were GGCCTCCAAGGAGTAAGAAA (forward) and GCCCCTCCTGTTATTATGG (reverse).

Enzyme-linked immunosorbent assay (ELISA)

Culture media were collected and centrifuged at 1000×g for 20 min to obtain the supernatant for ELISA. The levels of IL-1β, TNF-α, Arg-1, IL-4, and IL-10 were determined using the Mouse IL-1β ELISA Kit (product number: KS10929), Mouse TNF-α ELISA Kit (product number: KS10484), Mouse Arg-1 ELISA Kit (product number: KS13668), Mouse IL-4 ELISA Kit (product number: KS11806), and Mouse IL-10 ELISA Kit (product number: KS10138), respectively. The five kits were manufactured by Shanghai Keshun Science and Technology Co., Ltd. (China). The levels of IL-6 were measured using a Mouse IL-6 ELISA Kit (product number: L20268-48 T; Shanghai Jianglai Biotechnology Co., Ltd., China) according to the manufacturer’s protocol.

Immunofluorescence

The cell slides were washed twice with 1 × phosphate-buffered saline (PBS; pH 7.4) and fixed with 4% formaldehyde solution at room temperature for 10 min. After washing the cells thrice with PBS, they were permeabilized with 0.3% Triton X-100 solution at room temperature for 10 min. After washing the cells three times with PBS, a 5% bovine serum albumin-blocking solution was added, and the cells were incubated at room temperature for 15 min. After removing the excess solution without washing, the primary antibody (dilution ratio: 1:50 for CD86 and 1:75 for CD163) was added and incubated at 4 °C overnight. The cells were washed thrice with PBS for 2 min each. Secondary antibodies were diluted 1:500, and Alexa Fluor® 488 (green) goat anti-rabbit IgG (H + L) was added and incubated at room temperature in the dark for 1 h. The cells were washed thrice with PBS for 2 min each. Subsequently, 50 μL of 4,6-diamino-2-phenyl indole (DAPI) staining was added for 10 min. The cells were washed thrice with PBS for 2 min each and mounted with an antiquenching agent. Images were obtained using a fluorescence microscope, and photographs were taken.

Cell counting kit-8 assay

mCAECs (600 μL, 2 × 105 cells/mL) were seeded in the lower chamber of a transwell cell culture plate. The following day, BV-2 cells from each group (200 μL, 2 × 105 cells/mL) were seeded into the upper chamber of a transwell cell culture plate. After co-culturing for 24 h, the mCAECs were harvested and transferred to a 96-well culture plate. mCAECs were cultured for 0, 3, 5, and 7 days, after which 10 μL of Cell Counting Kit-8 solution was added to each well. Following a 2-h incubation in the cell culture incubator, the absorbance at 450 nm was measured using a microplate reader. The optical density at 450 nm (OD450) of the blank group on day 0 was designated as the control group OD450 nm, whereas the OD450 values of the other groups at various time points were designated as the experimental group OD450 nm. The proliferation rate of mCAECs was calculated using the following formula: cell proliferation rate = (experimental group OD450 nm/control group OD450 nm − 1) × 100%.

Transwell assay and transwell-matrigel assay

To investigate the effect of different groups of BV-2 cells on the migration ability of mCAECs, a transwell assay was performed. mCAECs (200 μL, 2 × 105 cells/mL) were resuspended in FBS-free culture medium and seeded in the upper chamber of a transwell cell culture plate. BV-2 cells (600 μL, 2 × 105 cells/mL) were resuspended in culture medium containing 20% FBS and seeded into the lower chamber of a transwell cell culture plate. The transwell plates were placed in a cell culture incubator for normal cultivation. After 24 h, the mCAECs that had not migrated through the polycarbonate membrane in the upper chamber were gently removed using a cotton swab. Transwell chambers were fixed in 4% paraformaldehyde solution for 20 min, sequentially rinsed in PBS, stained with crystal violet for 10 min, rinsed again in PBS, and observed under a microscope to count the number of mCAECs that migrated through the polycarbonate membrane in each field. Eight fields were randomly selected for imaging. ImageJ Pro software was used to count the migrated cells in the transwell plate, and the average number of cells in each field was calculated as the number of migrated mCAECs in each group. To investigate the effects of different groups of BV-2 cells on the invasive ability of mCAECs, a transwell-Matrigel assay was performed. In addition to the upper chamber of the transwell cell culture plate pre-coated with Matrigel, the other protocol was the same as that for the transwell assay.

Tube formation assay

The Matrigel was dissolved overnight at 4 °C and centrifuged for 1 min at 4 °C after complete dissolution. The mixture was gently mixed, and 150 μL of Matrigel was added to the lower chamber of the pre-chilled transwell cell culture plates and incubated at 37 °C for 45 min. Simultaneously, 600 μL of mCAECs (1 × 105 cells/mL) was seeded in the lower chamber and incubated under normal conditions. The next day, 200 μL BV-2 cells (2 × 105 cells/mL) from different groups was seeded into the upper chamber of the transwell cell culture plate. Tube formation was observed after co-culturing for 6 h. Subsequently, six random fields were photographed, and ImageJ Pro software was used to quantify the number of tubes formed, providing an evaluation index of the tube formation ability of mCAECs.

Western blotting

After various treatments, BV-2 cells or mCAECs from each group were collected, and their total proteins were extracted using RIPA lysis buffer. Subsequently, 30 µg of protein was separated using sodium dodecyl-sulfate polyacrylamide gel electrophoresis and transferred onto a polyvinylidene fluoride (PVDF) membrane. The PVDF membrane was blocked using 5% skim milk powder solution diluted in Tris-buffered saline (TBS), and the primary antibodies (1:1000 for vascular endothelial growth factor receptor 2 (VEGFR2), 1:1000 for nuclear factor kappa B (NF-κB) p65, 1:1000 for phosphorylated (p)-NF-κB p65, 1:2000 for AMPK alpha, 1:2000 for AMPK gamma, and 1:3000 for glyceraldehyde 3-phosphate dehydrogenase) were diluted with 5% skim milk powder solution to incubate the PVDF membrane. The PVDF membrane was washed with TBS containing 1‰ Tween-20 (TBST), and the horseradish peroxidase-conjugated secondary antibody (1:5000 dilution) was diluted with a 5% skim milk powder solution for further incubation of the PVDF membrane. After an additional wash with TBST, the horseradish peroxidase signal was visualized using SuperSignal West Pico PLUS (Thermo Scientific, Rockford, IL, USA), and the signals were captured on an X-ray film.

Label-free quantification proteomics

BV-2 cells transfected with the pcDNA3.1 + and pcDNA-NEAT1 vectors were collected for label-free proteomic quantification. All label-free quantification proteomic procedures were performed by Wuhan GeneCreate Biological Engineering Co., Ltd. (China). Briefly, total protein was extracted using RIPA lysis buffer. Mass spectrometry was performed after protein denaturation and trypsin digestion. Raw mass spectrometry data were analyzed using MaxQuant (V1.6.6) software with the Andromeda algorithm. Protein identification was performed using the UniProt mouse proteome reference database. The results were filtered at a 1% false discovery rate at both protein and peptide levels, removing reverse and contaminant proteins and proteins with only one modified peptide. The remaining information was used for subsequent statistical, clustering, and differential protein abundance analyses to identify proteins that were differentially expressed in BV-2 cells transfected with pcDNA-NEAT1. Furthermore, all identified differentially expressed proteins were subjected to Gene Ontology terms (including Biological Process, Cellular Component, and Molecular Function) and Kyoto Encyclopedia of Genes and Genomes pathway annotation using the Diamond program in the eggNOG-mapper software, followed by functional enrichment analysis using hypergeometric testing.

Statistical analysis

Statistical analyses were performed using GraphPad Prism version 7.0 (GraphPad Software, San Diego, CA, USA). One-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test was used to assess the significance of the differences. Statistical significance was set at P < 0.05.