Manipulating iturin A synthetase gene cluster for iturin A production

Promoter replacement is an effective strategy for gene expression regulation, which has been applied in the efficient production of various lipopeptides (surfactin, lichenysin, fenycin, and iturin A) (Jiao et al. 2017; Qiu et al. 2014; Xu et al. 2020; Yaseen et al. 2016). The dual promoter Pdual3 constructed in our previous research has been proven as an effective promoter in gene expression enhancement (Rao et al. 2020). Here, the original promoter (Pitu) of iturin A synthase gene cluster was replaced by Pdual3, obtained recombinant strain HZ-T1 (HZ-Pdual3-ituD), and strain HZ-PbacA, in which Pitu was replaced by promoter PbacA in our previous research (Xu et al. 2020), was served as the control strain, as well as original strain HZ-12. Based on our results of Fig. 2, iturin A yields were significantly increased in promoter replacement strains, and the highest yield was attained by HZ-T1, reached 1.25 g/L, increased by 2.05-fold compared to HZ-12 (Fig. 2A). In addition, transcription levels of genes ituD, ituA, ituB, and ituC were all increased at logarithmic and stationary phases (Fig. 2B), and increase ratios of downstream genes (ituA, ituB, and ituC) were lower than those of ituD.

Fig. 2

Strengthening iturin A synthetase cluster expression in HZ-12 (wild-type strain) for iturin A production. A Iturin A yield and cell biomass and B transcriptional levels of genes ituA, ituB, ituC, and ituD

5′-UTR served as the critical role in mRNA secondary structure stability and translation initiation (Xiao et al. 2020). Here, to further improve genes ituA, ituB, and ituC expression for iturin A synthesis, the original 5′-UTRs of these genes were optimized in the following work. Firstly, 5′-UTR of gene ituA in HZ-T1 was replaced by UTR12 (GTATATTAGAAAGGAGGAATATATA), which was attained in our previous research (Xiao et al. 2020), and iturin A yield produced by the resultant strain HZ-T2 was 1.73 g/L, increased by 38.40% compared to HZ-T1 (Fig. 3A). Meanwhile, the mRNA secondary structures of 5′-UTRs with the first 30 bp of gene ituA were predicted on Mfold program, and our results implied that 5′-UTR replacement decreased ΔG of mRNA secondary structure, which benefited mRNA secondary structure stability and gene expression (Fig. 3 B and C), and this might be reason for the increase of iturin A yield in HZ-T2 (HZ-Pdual3-ituD-UTRUTR12-ituA). Then, original 5′-UTRs of ituB and ituC were, respectively, replaced by UTR12 and UTR9 (GGTACATTAGAAAGGAGGAATGTACC) in HZ-T2, basing on the matching between 5′-UTR with relative gene sequences (Figure S1), and iturin A yield of the recombinant strain HZ-T3 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC) was further increased to 2.32 g/L, increased by 85.60% compared to HZ-T1 (Fig. 3A). Thus, our results implied that 5′-UTR optimization was an efficient approach to regulate the expression of downstream genes in synthetase cluster.

Fig. 3

Optimizing the 5′-UTRs of genes ituB, ituC, and ituD in HZ-T1 (HZ-Pdual3-ituD) for enhanced production of iturin A. A Iturin A yield and cell biomass, B mRNA secondary structure of gene ituB with its original 5′-UTR, and C the mRNA secondary structure of UTR12 with gene ituB

Enhancing the substrate utilization for iturin A synthesis

In the previous research of our group, B. amyloliquefaciens HZ-12 was attained for the production of α-glucosidase inhibitor 1-DNJ (Cai et al. 2017); however, 1-DNJ produced by HZ-T3 might decrease α-glucosidase activity, which was not conducive to corn starch utilization and iturin A synthesis. 4-Aminobutyrate transaminase encoded by gene gabT1 catalyzes the critical step of 1-DNJ synthesis (Onose et al. 2013); here, gabT1 was deleted in strain HZ-T3 to attain HZ-T4 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1). Based on the results of Fig. 4, iturin A yield produced by HZ-T4 was 3.13 g/L, increased by 34.91% and 6.63-fold compared to HZ-T3 and HZ-12, respectively (Fig. 4A). Meanwhile, 1-DNJ content of HZ-T4 was significantly decreased from 23.26 to 4.23 mg/L, while α-glucosidase activity was increased by 87.08%, respectively (Fig. 4B). In addition, the maximum cell biomass of strain HZ-T4 was higher than that of HZ-T3. Taken together, our results implied that enhancing α-glucosidase activity via blocking 1-DNJ synthetic pathway benefited corn starch utilization, which further benefited iturin A production.

Fig. 4

Improving corn starch utilization by blocking 1-DNJ synthesis pathway in HZ-T3 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC) to increase iturin A production. A Iturin A yield and cell biomass and B 1-DNJ yield and α-glycosidase activity

Strengthening fatty acid and precursor amino acid supplies for iturin A synthesis

Enhancing precursor supply is a common and effective strategy for target product production (Zhu et al. 2021). As for iturin A, the accumulations of free fatty acids and precursor amino acids might be the limiting factor for its synthesis. Here, to increase fatty acid supplies, three promoters (P43, PbacA, and Pdual3) were applied for yngH expression in HZ-T4, resulting in strains HZ-T5 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-P43-yngH), HZ-T6 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH), and HZ-T7 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-Pdual3-yngH), respectively. Basing on the results of Fig. 5, transcriptional levels of yngH were all increased in the promoter replacement strains (Figure S2), and iturin A yields were increased by 9.58%, 26.52%, and 12.46%, respectively, and the best performance was attained by strain HZ-T6 (Fig. 5A). In addition, the contents of free fatty acids were all increased in HZ-T6 (Fig. 5B).

Fig. 5

Strengthening precursor (fatty acids and amino acids) supplies in HZ-T4 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1) for iturin A production. A Iturin A yield and cell biomass, B the concentrations of fatty acids, C effects of precursor amino acid additions on iturin A yield, D strengthening precursor Ser and Pro synthesis pathways for iturin production, E transcriptional levels of genes serC and serB, and F the concentrations of intracellular Ser and Pro

Compared to surfactin, amino acid composition of iturin A was complicated, which might be the reason for low synthetic capability of iturin A in Bacillus. In order to excavate the limiting precursor amino acid that is hindering iturin A synthesis, 40 mg/L Asn, Tyr, Gln, Pro, and Ser were, respectively, added into iturin A production medium at 24 h, and iturin A yields were, respectively, increased by 21.46% and 6.82% in Ser- and Pro-feeding groups (Fig. 5C), suggesting that Ser and Pro might be the limiting amino acids for iturin A synthesis in HZ-T6; however, Asn, Tyr, and Gln additions have no effect on iturin A production. Then, to improve intracellular Ser supply for iturin A production, original promoters of 3-phosphoserine aminotransferase SerC and phosphoserine phosphatase SerB were, respectively, replaced by promoter PbacA in HZ-T6, resulting in recombinant strains HZ-T8 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC) and HZ-T9 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serB), respectively. The transcriptional level of serC was increased by 1.54-fold, and intracellular concentration of Ser was increased by 48.08%, which led to a 21.97% enhancement of iturin A yield. Overexpression of SerB have no effect on iturin A production, although transcription level of serB was enhanced in HZ-T9 (Fig. 5 D and E). In B. amyloliquefaciens HZ-12, Pro was synthesized from Gln, under the catalysis of gene cluster proABC; however, strengthening ProABC expression (HZ-T10 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC-PbacA-proABC)) has no effect on the intracellular Pro concentration and iturin A yield in this research. In addition, Pro can also be converted from ornithine, under the catalysis of ornithine cyclodeaminase Ocd in Bacillus thuringiensis. Here, gene ocD from B. thuringiensis BMB171 (NC_014171.1) was introduced into HZ-T8, resulting in strain HZ-T11 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC-PbacA-ocd). The concentration of intracellular Pro was increased by 53.37% in HZ-T11, and iturin A yield was increased to 5.52 g/L by 14.29% compared to HZ-T8 (Fig. 5 D and F), which was positively correlated with the previous research (Chen et al. 2022). Thus, our results demonstrated that strengthening precursor (fatty acids, Ser, and Pro) supplies was an efficient approach for iturin A production.

Blocking the by-product synthetic pathways for iturin A synthesis

The syntheses of by-products will not only affect the conversion ratio of raw materials, but also influence the fermentation quality, and increase the difficulty of separation and extraction, which is not conducive to the efficient production of target production. γ-PGA is a natural multi-functional biopolymer that was mainly produced by Bacillus, and high viscosity of γ-PGA will affect oxygen supply and product separation (Cai et al. 2018). Here, gene pgsB encoding for γ-PGA synthetase was deleted in HZ-T11, and iturin A produced by the resultant strain HZ-T12 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC-PbacA-ocd△pgsB) was 6.33 g/L, increased by 14.67% compared to HZ-T11 (Fig. 6A). Furthermore, genes epsAB and srfA, which are responsible for extracellular polysaccharide and surfactin syntheses (Wu et al. 2019), were deleted in HZ-T12 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC-PbacA-ocd△pgsB△epsAB△srfA), which led to the significant decreases of extracellular polysaccharide and surfactin yields (Fig. 6B), and iturin A yield was further increased by 14.22% to 7.23 g/L, compared to HZ-T12.

Fig. 6

Blocking the by-product synthetic pathways in HZ-T11 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC-PbacA-ocd) for iturin A synthesis. A Iturin A yields and cell biomasses and B the yields of by-products γ-PGA, extracellular polysaccharide, and surfactin

Strengthening lipopeptide transporter for iturin A production

An excellent transporter is very important for efficient production of target products, especially for the product which inhibits cell growth and metabolism (Li et al. 2010). Previously, YcxA, KrsE, and SwrC were reported as lipopeptide exporters for surfactin production (Li et al. 2015); however, which one mediates iturin A transport is unclear. Here, YcxA, KrsE, and SwrC overexpression strains were constructed basing on HZ-T13, attained in recombinant strains HZ-T13/pHY-YcxA, HZ-T13/pHY-KrsE, and HZ-T13/pHY-SwrC. Based on the results of Fig. 7A, plasmid introduction increased cell maintain metabolite energy, which decreased iturin A production. SwrC overexpression benefited iturin A transport, and iturin A yield was increased to 7.64 g/L by 12.02%, and cell biomass was increased by 6.60%, compared to control strain HZ-T13/pHY300, respectively. However, overexpression of YcxA or KsrE has no effect on iturin A production. Subsequently, the original promoter of SwrC was replaced by promoter PbacA in HZ-T13, resulting in strain HZ-T14 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC-PbacA-ocd△pgsB△epsAB△srfA-PbacA-swrC), and iturin A yield produced by HZ-T14 reached 8.53 g/L, increased by 17.98% compared to HZ-T13.

Fig. 7

Overexpression of lipopeptide transporters in HZ-T13 (HZ-Pdual3-ituD-UTRUTR12-ituA-UTRUTR12-ituB-UTRUTR9-ituC△gabT1-PbacA-yngH-PbacA-serC-PbacA-ocd△pgsB△epsAB△srfA) for iturin A production. A Iturin A yields and cell biomasses and B the fermentation process curves of strains HZ-12 and HZ-T14

Finally, the fermentation process curves of strains HZ-12 and HZ-T14 were measured during iturin A production. Based on the results of Fig. 7B, cell biomasses of HZ-T14 were higher than those of HZ-12 throughout the fermentation process, and the maximum cell biomass was increased by 21.99%. Iturin A was synthesized after 24 h, and maximum yield of HZ-T14 reached 8.53 g/L, increased by 19.80-fold compared to HZ-12, which was the highest iturin A yield reported so far (Table S1).