Human specimens

The RNA sequencing dataset of CRC patients was downloaded from TCGA. Patients with missing survival and metastasis data were excluded. A total of 370 CRC patients, including 312 without distant metastasis and 58 with distant metastasis, were included in the study.

We obtained 150 pairs of fresh CRC tissues and their corresponding adjacent nontumor colorectal tissues from patients (87 males and 63 females; median age, 63 years; age range, 29 to 81 years). The samples were collected at the Department of Gastrointestinal Surgery, the First Affiliated Hospital of China Medical University. All specimens were pathologically diagnosed as CRC and classified using the guidelines of UICC article 8th. After excluding patients with incomplete clinical data, the patients were divided into high expression and low expression groups according to the median expression of C6orf15, and the correlation between its expression and clinicopathological characteristics such as age, gender, tumor size, differentiation, lymph node metastasis, distant metastasis were analyzed. All studies were conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of the First Hospital of China Medical University. In addition, informed consent was obtained from each patient.

Cell lines

Two human-derived CRC cell lines (HCT116 and RKO) and one C57B6 murine-derived CRC cell line (MC38) were obtained from the cell bank of the Chinese Academy of Sciences (Shanghai, China). HCT116 and MC38 cells were cultured in DMEM containing 10% foetal bovine serum (FBS; Hy Clone, Logan, UT, USA) and 100 U/ml penicillin‒streptomycin (SH30243.01, Hy Clone, Logan, Utah, USA) in a humidified incubator with 2% CO2 at 37 °C. RKO cells were cultured in RPMI-1640 (11875093, Gibco, Waltham, MA, USA) supplemented with 10% FBS. All cell lines used in this study were validated by short tandem repeat (STR) genotyping.

Differential expression analysis and gene set enrichment

RNA-seq differential expression analysis of the TCGA database was performed using the R package “limma”. Differentially expressed genes between tumour samples with and without distant metastases were defined as upregulated or downregulated genes with a fold change > 1 and a false discovery rate (FDR) of P < 0.05. The gene sets were identified by gene set enrichment analysis (GSEA) of the Hallmark gene set of “MSigDB” (Molecular Signatures Database, version 6.0). In addition, the enrichment score was calculated by determining the expression of the gene set. We considered a gene set to be “enriched” when the majority of its expression was either elevated or reduced. GEPIA was used for the correlation analysis of target genes and survival.

RNA isolation and quantification by real-time fluorescence quantitative PCR

Total RNA from CRC cell lines and 48 colorectal tissue samples was extracted with TRIzol reagent (Takara Bio, Otsu, Japan) according to the manufacturer’s instructions and then stored in liquid nitrogen. A NanoDrop ND-1000 instrument (NanoDrop, USA) was used to measure the total mRNA concentration, and an RT‒PCR quantification kit (Shanghai, China) was used for reverse transcription. qRT‒PCR was performed using a SYBR real-time PCR kit (Takara) with Quant Studio 6 Flex according to the manufacturer’s instructions, with GAPDH serving as an internal control. The thermal cycling conditions were 95 °C for 3 min, followed by 45 cycles of 95 °C for 12 s and 62 °C for 45 s. The following primers were used: C6orf15 forward primer TGCTCCTGGTCTGTCTTCATCTCC and reverse primer GGCTGCGGATGTTCAGAGTTAGAG. The GAPDH internal primers were purchased from Gemma Genetics (Shanghai, China). Each experiment was performed three times in duplicate.

Protein isolation and western blotting

Total protein was extracted from three infected CRC cell lines (HCT116, RKO, and MC38) using RIPA lysis buffer supplemented with 1% PMSF. Total protein was separated using a 10% sodium dodecyl sulfate‒polyacrylamide gel and then transferred to a PVDF membrane. The membranes were blocked with 5% skim milk for 2 h and then incubated with rabbit anti-C6orf15 (Proteintech, USA; 1:1000 dilution), rabbit anti-β-catenin (Proteintech, USA; 1:1000 dilution), rabbit anti-ZEB1 (Abmart, Shanghai; 1:1000 dilution), rabbit anti-E-cadherin (Abmart, Shanghai; 1:1000 dilution), rabbit anti-N-cadherin (Abmart, Shanghai; 1:1000 dilution), rabbit anti-Vimentin (Proteintech, USA; 1:1000 dilution), rabbit anti-ZO-1 (Abmart, Shanghai; 1:1000 dilution), mouse anti-GAPDH (Abmart, Shanghai; 1:3000 dilution), rabbit anti-CPT1A (Proteintech, USA; 1:1000 dilution), and rabbit anti-LaminB1 (Proteintech, USA; 1:1000 dilution). The membranes were then incubated with secondary antibodies for 2 h. We assessed the protein blotting results using an enhanced chemiluminescence (ECL) assay kit (Thermo Fisher Scientific, Rockford, IL, USA), and each experiment was performed three times.

Immunohistochemical (IHC) staining

Consecutive 4-μm paraffin-embedded sections of CRC tissue were prepared, deparaffinized at 65 °C for 2 h, and then washed with PBS. Antigen retrieval was performed under high-temperature, high-pressure conditions for 3 min. Subsequently, the sections were incubated with hydrogen peroxide (3%) or 10% normal goat serum for 15 or 20 min, respectively. The sections were then incubated overnight at 4 °C with C6orf15 antibodies (CST, USA; 1:200), Vimentin antibodies (Proteintech, USA; 1:200), and ZEB1 (Proteintech, USA; 1:200). The sections were incubated with peroxidase-conjugated streptavidin–biotin complex for 15 min, followed by the addition of 3,3'-diaminobenzidine (DAB) for colour development. Visualization was performed at 20 × magnification. Immunohistochemistry (IHC) scores were calculated as the product of the staining area (< 5%, 0 points; 5–25%, 1 point; 26–50%, 2 points; 51–75%, 3 points; and 76–100%, 4 points and staining depth (no colour, 0; light yellow, 1; tan-yellow, 2; and brown‒yellow, 3). The total score for each section was further classified into four intensity grades: 0, negative (−); 1–4, weakly positive ( +); 5–8, positive (+ +); and 9–12, strongly positive (+ + +).

Establishment and transfection of stable cell lines

The C6orf15-overexpressing lentivirus, C6orf15-RNAi-Easy lentivirus and their corresponding negative controls (NCs) were synthesized by GENECHEM (Shanghai, China), and for transfections, Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) was used according to the manufacturer's instructions. To establish stable negative control and C6orf15 knockdown cells (HCT116-C6orf15-NC/KD, RKO-C6orf15-NC/KD), puromycin (P8230, Solarbio, Shanghai, China) was used to screen for cells in which C6orf15 was successfully knocked down. Similarly, negative control and C6orf15-overexpressing cells (HCT116-C6orf15-NC/OE, RKO-C6orf15-NC/OE, and MC38-C6orf15-NC/OE) were generated via the same method. The transfection efficiency was also assessed.

Cell migration assay

As described previously, stable C6orf15 overexpression, C6orf15-knockdown and negative control HCT116 and RKO cell lines were constructed. A total of 8 × 10^4 stable HCT116 cells and 5 × 10^5 stable RKO cells in 300 µl of serum-free medium was added to the upper chamber of a Transwell, and 600 μl of medium containing 10% foetal bovine serum was added to the lower chamber. CRC cells in the bottom membrane were fixed using cold methanol after 24 h and then stained with 0.1% crystal violet (Sigma) for 30 min. Photographs were taken using an EVOS automated imager, and the number of colonies in five random areas in each chamber were counted at × 20 magnification.

MTT assay to assess the viability of CRC cells

Cells were cultured in 96-well plates (5 × 104 cells/well). Twenty-four hours after plating, the medium was replaced with fresh medium containing 15 μL of MTT. After four hours of incubation at 37 °C, the medium was discarded, and DMSO (150 μL) was added to each well. Then, the absorbance was measured at 490 nm. The results are presented as the percent inhibition compared to that of the untreated control.

Immunofluorescence

Tissue sections of liver metastases and primary foci of colon cancer from the same patient were placed in xylene, anhydrous ethanol, 95%, 85%, and 75% alcohol in series and in water for deparaffinization and then placed in citric acid antigen repair solution. Next, the sections were incubated in 4% BSA for 30 min before they were incubated with a primary antibody [rabbit anti-C6orf15 (Proteintech, USA; 1:100 dilution)] at 4 °C overnight. The sections were then incubated with a fluorescent secondary antibody (Proteintech, USA). Nuclei were visualized using DAPI (Sigma, St. Louis, MO, USA), and the sections were analysed using an EVOS fully automated imager (Invitrogen, USA).

Establishment of a mouse model

Female 6- to 8-week-old C57B6 mice were purchased from Changsheng (Benxi, Liaoning, China). Mouse-related studies were performed in specific pathogen-free facilities, and all procedures were approved by the Institutional Animal Care and Use Committee of China Medical University (Shenyang, China), which complies with the National Institutes of Health regulations for the care and use of laboratory animals.

To establish a CRC liver metastasis mouse model, 1 × 106 MC38 cells overexpressing C6orf15 (MC38-C6orf15-OE) or control cells (MC38-C6orf15-NC) were injected into the spleens of C57B6 mice. At 20 days after injection, the mice were euthanized by cervical dislocation, and liver specimens were collected and photographed to record the size and number of metastatic lesions.

Seahorse extracellular flux analysis

Fatty acid oxidation (FAO) content was determined using a hippocampal XF96xe extracellular flux analyser (Agilent Technologies, North Billerica, MA, USA). The constructed C6orf15-overexpressing RKO CRC cells were seeded into XF96 plates containing DMEM supplemented with 10% FBS at a density of 30,000 cells/well and incubated for 2 days. Then, the cells were collected for a fatty acid oxidation (FAO) assay. Etomoxir, an inhibitor of carnitine ester acyltransferase-1 (CPT-1) and thus FAO, was added to the cells prior to the assay with other drugs in accordance with the instructions of the long-chain fatty acid oxidative metabolism pressure kit and preadded to the dosing wells. The specific dosing concentrations used were 4 µmol/L Eto, 1.5 µmol/L oligomycin, 1.0 µmol/L FCCP, and 0.5 µmol/L rotenone/antimycin A. The number of cells per well was determined using Seahorse XF imaging and cell counting software, and all OCR measurements were normalized to the number of cells in each well. Relative levels of fatty acid-driven basal and maximal mitochondrial respiration were calculated using Seahorse Wave software (Agilent).

Detection of the activity of the TOPflash plasmid luciferase reporter gene in the WNT signalling pathway

293 T cells in the experimental group were cotransfected with the C6orf15 overexpression plasmid (GENECHEM, Shanghai), TOPflash luciferase reporter gene plasmid and Renilla plasmid for 48 h, and 293 T cells in the control group were cotransfected with the C6orf15 null plasmid and TOPflash luciferase reporter gene plasmid as well as the Renilla plasmid. The level of β-catenin-mediated TCF/LEF transcriptional activity in the WNT signalling pathway was detected by the Luciferase Reporter Gene Plasmid Kit (Beyotime Biotechnology, China) 48 h after transfection.

Statistical analyses

The results of three independent experiments are expressed as the mean ± standard deviation. We performed all the statistical analyses using SPSS 17.0 statistical software (Chicago, IL, USA). Scientific plots were drawn using GraphPad Prism (GraphPad Software, USA). Student's t test was used to determine the relationship of C6orf15 expression with clinicopathological parameters and cell migration invasion. Pearson's correlation coefficient was used to explore the relationship between C6orf15 and β-catenin or ZEB1. Paired t tests were used to analyse C6orf15, β-catenin, ZEB1, Vimentin, N-cadherin, and E-cadherin protein expression. p < 0.05 was considered to indicate a statistically significant difference.