Cell culture and reagentsCells

PTHrP mutant cell lines were established in the laboratory of one of us (TJM) at St. Vincent’s Institute of Medical Research, as previously described [61]. Briefly, the following constructs were synthesized by Integrated DNA Technologies (IDT) (Coralville, IA, USA): Pthlh(-36-139), Pthlh (1-139), Pthlh(-36-67), Pthlh(-36-139). Xho1/ EcoR1 enzyme digestion and ligation was performed to clone the constructs into the murine stem cell virus (MSCV)-zeo plasmid. Each plasmid except for the MSCV control was tagged with a human influenza hemagglutinin (HA) epitope at the C-terminal end. DNA sequencing was performed by the Australian Genome Research Facility. Phoenix cells were then transfected with the mutant plasmids and used to infect MCF7 cells which were placed under antibiotic selection with Zeocin to establish stable lines. The resulting PTHrP mutant cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S). All cell lines were regularly tested for mycoplasma contamination.

Proliferation assays

Cells were plated at 1 × 106 cells per 10cm2 plate and allowed to adhere for 4–6 h. Adherent cells were then trypsinized and mixed with 0.4% trypan blue solution. Viable cells were determined based on dye exclusion and counted using a TC20 Automated Cell Counter (Bio-Rad). Proliferation of PTHrP mutant cells was monitored daily for four days by trypsinizing and counting viable cells.

LIFR inhibitor treatment

Cells were plated at 1 × 106 cells/ 10cm2 plate and allowed to adhere overnight. The following day, cells were treated with EC359, a leukemia inhibitory factor receptor (LIFR) inhibitor (50nM or 100nM; MedChemExpress; Catalog No. HY-1,201,420) or vehicle (0.1% dimethyl sulfoxide, DMSO) for 1, 6, or 24 h in full-serum media.

RNA extraction and real-time qPCR

RNA was extracted from cells using TRIzol (ThermoFisher) and prepared for real-time qPCR analysis as previously described [32]. Human primers for b2M [32] and CDKN1B (p27) were previously published. The following primers were designed using PrimerBlast (NCBI) against the human genome and validated by dissociation: ACTB (F- CATGTACGTTGCTATCCAGGC), R- CTCCTTAATGTCACGCACGAT). Mouse primers for HMBS were previously published [32]. The following primers were designed using PrimerBlast (NCBI) against the mouse genome (Mus musculus) and validated by dissociation: PTHrP mid-region (F- CATCAGCTACTGCATGACAAGG, R- GGTGGTTTTTGGTGTTGGGTG), PTHrP NLS (F- AACAGCCACTCAAGACACCC, R- GACCGAGTCCTTCGCTTCTT), PTHrP C-terminal region (F- AAAAGAAGCGAAGGACTCGG, R- GCGTCCTTAAGCTGGGCT).

Western blotting

Cultured cells were rinsed twice with cold 1X PBS and harvested in RIPA lysis buffer (Sigma) containing protease and phosphatase inhibitors (Roche). Protein lysate (20μg) was loaded onto an SDS-PAGE gel under reducing conditions and transferred to nitrocellulose membranes. Membranes were probed with antibodies against HA-Tag (Cell Signaling, C29F4, Catalog No. 37T4S, 1:1000), LIFR (Santa Cruz, C-19, Catalog No. sc-659, 1:1000), p21Waf1/Cip1(Cell Signaling, Catalog No. 2947 S, 1:1000), p27 Kip1 (Cell Signaling, Catalog No. 3686 S, 1:1000), phospho-p38 MAPK (Thr180/Tyr182) (Cell Signaling, Catalog No. 4511, 1:1000), p38 MAPK (Cell Signaling, Catalog No. 8690, 1:1000), phospho-ERK1/2 Thr202/Tyr204 (Cell Signaling, Catalog No. 9101, 1:1000), ERK1/2 (Cell Signaling, catalog number 9102, 1:1000), Calnexin (AbCam, Catalog No. ab22595-100UG, 1:900), GAPDH (Cell Signaling 14C10, Catalog No. 2118 S, 1:5000), HDAC2 (Cell Signaling, D6S5P, 1:1000), α-tubulin (Antibody & Protein Resource at Vanderbilt University, Catalog No. VAPRTUB, 1:5000), or Vinculin (Millipore, Catalog No. AB6039, 1:1000).

Nuclear and cytoplasmic extraction

Nuclear and cytoplasmic extracts were obtained from cultured PTHrP mutant cells using the NE-PER Nuclear and Cytoplasmic Extraction Reagents Kit (Thermo Scientific, Catalog No. 78,835) according to the manufacturer’s instructions. Briefly, 5 × 106 cells were plated in full serum DMEM and allowed to adhere overnight. The following day, adherent cells were trypsinized and centrifuged at 500 x g for 5 min, and the pellet was suspended in PBS. Cells were then transferred to a new microcentrifuge tube and centrifuged at 500 x g for 3 min. Supernatant was discarded and 500 µl of ice-cold CER I with 5 µl of protease inhibitor was added to the cell pellet and vortexed. The cell suspension was incubated on ice for 10 min. Ice-cold CER II (27.5 µl) was then added to the tube, vortexed, and incubated on ice for 1 min. Next, the sample was vortexed and centrifuged at 16,000 x g for 5 min. The supernatant (cytoplasmic extract) was immediately transferred to a clean pre-chilled tube and stored at -80oC. The cell pellet was suspended in 250 µl of ice-cold NER, vortexed for 15 s, and placed on ice. Vortexing was repeated every 10 min for a total of 40 min. The tube was then centrifuged at 16,000 x g for 10 min. Finally, the supernatant (nuclear extract) was transferred to a clean pre-chilled tube and stored at -80oC.

Immunocytochemistry

For analysis of HA-tagged PTHrP peptides, cells were seeded onto a 4-well culture slide at 6 × 105 cells/ well and allowed to adhere overnight. The following day cells were washed twice with 1x PBS and fixed with 10% formalin for 15 min. Cells were then washed three times with 1X PBS for 5 minutes each, permeabilized in 0.25% Triton-X in 1X PBS for 10 min and washed twice with 1X PBS for 5 minutes each. Next cells were blocked in a 3% mix of donkey horse serum (DHS)/ bovine serum albumin (BSA) for 1 h at room temperature, washed twice with 1X PBS for 5 minutes each and finally incubated with HA-Tag antibody (Cell Signaling, C29F4, Catalog No. 37T4S, 1:500) diluted in DHS/ BSA mix for 1 h at room temperature. Afterwards, cells were washed three times with 1X PBS for 5 minutes each and incubated in goat anti-rabbit IgG (H + L) Alexa Fluor 488 secondary antibody (Thermo Fisher, Catalog No A-11,034, 1:1000) diluted in DHS/ BSA mix in the dark for 1 h at room temperature. Cells were then washed three times with 1X PBS for 5 minutes each. Lastly, the chamber was removed from each slide before mounting coverslips with VECTASHIELD HardSet Antifade Mounting Medium with DAPI (Vector Laboratories). Fixed cells were imaged on a laser scanning confocal microscope Nikon A1r based on a TiE motorized Inverted Microscope using a (I) 60X lens, NA 1.4, run by NIS Elements C software with sections imaged in 0.23 μm slices or (II) 100X lens, NA 1.49, run by NIS Elements C software with sections imaged in 0.23 μm slices.

For analysis of p21 and p27, 8 × 105 cells were seeded onto glass coverslips coated with 5 µg/ml human fibronectin (Millipore) 1–2 h prior. The following day, cells were washed with 1X PBS, fixed with 10% formalin for 15 min, washed three times with 1X PBS for five minutes each and permeabilized with 0.25% Triton-X for 10 min. Afterwards, cells were washed twice with 1X PBS for 5 minutes each and blocked with DHS/ BSA mix for 1 h at room temperature. Cells were then washed twice with 1X PBS for 5 minutes each and incubated in p21Waf1/Cip1(Cell Signaling, Catalog No. 2947 S, 1:1000) or p27 Kip1 (Cell Signaling, Catalog No. 3686 S, 1:1000) diluted in DHS/BSA mix for 1.5 h at room temperature. Afterwards cells were washed three times with 1X PBS for 5 minutes each and incubated in goat anti-rabbit IgG (H + L) Alexa Fluor 488 secondary antibody (Thermo Fisher, Catalog No A-11,034, 1:1000) diluted in DHS/ BSA mix in the dark at room temperature. Finally, cells were washed three times with 1X PBS for 5 minutes each before mounting on glass slides with VECTASHIELD HardSet Antifade Mounting Medium with DAPI (Vector Laboratories). Images were collected on an Olympus BX41 Microscope equipped with an Olympus DP71 camera using the 40X plain objective. For p21 quantitation in Image J, total nuclei and positive staining cells were counted manually to calculate the percent of positive staining cells. For p27, the fluorescence intensity was quantified using ImageJ with manual cell contouring and measurement of the Raw Integrated Density which was averaged across all cells from 3 separate images.

Enzyme-linked immunosorbent assay

To prepare conditioned media, PTHrP mutant cells (1 × 105) were plated in full-serum media in a 24-well plate and allowed to adhere for 24 h. Afterwards, the full-serum media was changed to 600 µl of reduced serum media (DMEM + 2% FBS + 1% P/S) and cells were incubated for 24 h. Conditioned cell media was then harvested and centrifuged at 1500 rpm for 10 min at 4 °C. The supernatant was treated with protease inhibitor (Sigma, P8340, 1:100) before further analysis. Undiluted conditioned media was added to 96-well ELISA plates to measure secreted PTHrP levels according to the manufacturer’s protocol (Creative Diagnostics, Catalog No. DEIA2034). For the final analysis, calculated PTHrP concentrations measured by the ELISA were normalized to the total protein concentration (mg/ml) in each sample measured by BCA assay (Thermo Fisher).

Cell cycle analysis

Cell cycle analysis was performed by seeding 150,000 cells per well into 6-well plates for each cell line. After 24 h, cells were treated with 50nM EC359, 100nM EC359, or DMSO vehicle for 48 h. After 48 h, 150,000 cells were removed from each treatment group and live stained with Hoescht 33342 (AbCam) at a concentration of 10 µg/mL for 1 h at 37 °C. Stained cells were analyzed on a 4 Laser Fortessa by the Vanderbilt Flow Cytometry Resource Core. Flow cytometer data were analyzed using FlowJo software to gate for G0/1, S, and G2 phases. Each bar represents data from 3 independent experiments.

Migration assay

Scratch assays were performed by seeding 400,000 cells of each mutant cell line (MSCV, FLSEC, DNLS, and DNLS + CTERM) into one well of a 6-well plate. After 24 h, three scratches were made in each well with a pipette tip. Images were taken at 100x on an inverted microscope at 0 h (immediately after scratch), 24 h, and 48 h. Percent closure was determined via analysis with ImageJ. Each replicate is expressed as an average of three scratches per well. Each data point represents three independent experiments.

Animal studies and imagingAnimals

Experiments were performed under the regulations of the Animal Welfare Act and the Guide for the Care and Use of Laboratory Animals and approved by the Vanderbilt University Institutional Animal Care and Use Committee (IACUC). For the mammary fat pad study, 17β-estradiol pellets (0.36 mg/pellet; Innovative Research of America, Catalog No. SE-121) were subcutaneously implanted into female athymic nude mice 24 h prior to tumor inoculation [61]. The following day, 5 × 105 tumor cells from each pooled cell line in 20 µl PBS + 50% matrigel (Fisher Scientific) were inoculated into the fourth mammary fat pad (n = 10 mice injected per group). Tumor volume was assessed by caliper measurement. Several mice had to be sacrificed early due to estrogen-induced toxicities resulting in MSCV = 8 mice, FLSEC = 7 mice, DNLS = 10 mice, DNLS + CTERM = 9 mice in the final analysis. For the intracardiac inoculation study, 6-week-old female athymic nude mice (Jackson, Catalog No. 7850) were injected with 1 × 105 tumor cells from each pooled cell line as previously described [63] (n = 8–10 mice injected per group). The mice were subcutaneously implanted with a slow-release 17β-estradiol pellet (0.36 mg/pellet; Innovative Research of America, Catalog No. SE-121) 24 h prior to tumor cell injection [63].

Radiography

Radiographic (x-ray) images were obtained as previously described [64]. Briefly, a Faxitron LX-60 (34 kV for 8 s) was used to acquire x-ray images and images were quantified for osteolytic lesion number and area using ImageJ software.

Histology

Upon sacrifice of the mice, dissected tumors were fixed in 10% formalin for 48 h and stored in 70% ethanol until being paraffin-embedded for further analyses. Tissue sections were deparaffinized by heating the slides to 50 °C and placed in xylene for 5 min and then 3 min. Next, slides were soaked in 100%, 95%, and then 75% ethanol for 3 min each. Slides were slowly changed to deionized water and rinsed twice in water. The slides were immersed in 10 mM TRIS (pH 9.0) and 1 mM EDTA heated to 150 °C for 20 min. After cooling at room temperature for 20 min, slides were rinsed twice with water and then three times with 1X PBS followed by blocking with 10% BSA in PBS for 2 h. Sections were stained with Ki67 (Thermo Fisher; Catalog No. RM9106S0, 1:500), cleaved PARP (Asp214) (Cell Signaling Technology, Catalog No. 5625T, 1:500), HA-Tag (Cell Signaling, C29F4, Catalog No. 37T4S, 1:1000), p21Waf1/Cip1(Cell Signaling, Catalog No. 2947 S, 1:1000), or p27 Kip1 (Cell Signaling, Catalog No. 3686 S, 1:1000) in 3% BSA in PBS overnight at 4 °C. The following day, sections were washed three times with 1X PBS and incubated in goat anti-rabbit IgG (H + L) Alexa Fluor 488 secondary antibody (Thermo Fisher, Catalog No A-11,034, 1:1000) in 3% BSA/PBS in the dark at room temperature for 1 h. Finally, sections were washed three times with 1X PBS and coverslips were mounted using VECTASHIELD HardSet Antifade Mounting Medium with DAPI (Vector Laboratories). For LIFR staining, after blocking in 10% BSA for 2 h, slides were incubated in FITC-LIFR (Santa Cruz, Catalog No. sc-515,337, 1:50) in 3% BSA/PBS overnight at 4 °C. The following day, sections were washed three times with 1X PBS and coverslips mounted using VECTASHIELD HardSet Antifade Mounting Medium with DAPI (Vector Laboratories).

All images except for Ki67 were collected on an Olympus BX41 Microscope equipped with an Olympus DP71 camera using the 40X plain objectives. For LIFR quantitation, 40X images were used and an area measuring 1900 × 1180 pixels was selected to measure the Raw Integrated Density. The Raw Integrated Density from 3 representative images was averaged for each mouse and these values are reported in the figure. For p21, p27, and cleaved PARP, the quantitation was performed using ImageJ analysis of the 40X images. Positive staining nuclei and total cell counts were determined using color thresholding in ImageJ and the number of positive staining nuclei was divided by the total number of nuclei present to calculate the percent positivity. For Ki67 quantification, fixed samples were imaged on a laser scanning confocal microscope Nikon A1r based on a TiE motorized Inverted Microscope using a 60X lens, NA 1.4, run by NIS Elements C software. Sections were imaged in 0.4 μm slices. Positive staining nuclei and cell counts were determined using color thresholding in ImageJ and the number of positive staining nuclei was divided by the total number of nuclei present to calculate percent Ki67 positivity.

Flow Cytometry

One hindlimb (inclusive of bone marrow and tumor cells) was crushed with a mortar and pestle to obtain the bone marrow. PBS (1mL) was added to the crushed bone marrow and spun down and washed with PBS to remove bone debris. Bone marrow (5 × 105 cells) was stained in 100µL of PBS with LIVE/DEAD™ Fixable Green Dead Cell Stain Kit @488nm (Thermo Fisher Scientific, Catalog Number L34970, 1:1000) for 15 min on ice at 4 °C in the dark. Cells were washed with PBS and resuspended with 100µL of 1% BSA in PBS with CD298 antibody (BioLegend, Cat #341,704) for 30 min on ice at 4 °C in the dark.

Flow Cytometry Analysis

Flow cytometry experiments were performed in the VUMC Flow Cytometry Shared Resource using the 5-laser BD LSRII and 4-laser BD Fortessa LSRII. Data was analyzed using FlowJo software (FlowJo, LLC) where bone marrow samples were gated based on forward scatter and side scatter geometry, and PE-CD298 (+) cells were gated using live cells (LIVE/DEAD-Green negative) as previously validated in tumor-bearing bone marrow samples [45]. MCF7 breast cancer cells were used as a positive control for CD298 stain.

Statistics and reproducibility

For all experiments, n per group is as indicated by the figure legend and the scatter dot plots indicate the mean of each group and error bars indicate the standard error of the mean. All graphs and statistical analyses were generated using Prism software (Graphpad). Statistical significance for all in vitro and in vivo assays was analyzed using an unpaired t-test, one-way ANOVA with Sidak’s multiple comparisons test or two-way ANOVA with multiple comparisons, as indicated in the figure legends. For each analysis p < 0.05 was considered statistically significant, and *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.