ORIGINAL ARTICLE Year : 2022  |  Volume : 15  |  Issue : 9  |  Page : 418-424

Genetic diversity of Leishmania donovani isolates from cutaneous lesions of military personnel in the Mullaitivu and Kilinochchi districts of the Northern Province, Sri Lanka

Tharaka Wijerathna1, Nayana Gunathilaka1, Saveen Semege2, Nishantha Pathirana3, Wasana Rodrigo4, Deepika Fernando5
1 Department of Parasitology, Faculty of Medicine, University of Kelaniya, Ragama, Sri Lanka
2 Directorate of Army Preventive Medicine & Mental Health Services, Army Headquarters, Sri Jayawardenepura, Sri Lanka
3 Sri Lanka Army Hospital, Colombo, Sri Lanka
4 Department of Zoology, Faculty of Natural Sciences, Open University of Sri Lanka, Nawala, Nugegoda
5 Department of Parasitology, Faculty of Medicine, University of Colombo, Sri Lanka

Date of Submission03-Jun-2022Date of Decision10-Aug-2022Date of Acceptance24-Aug-2022Date of Web Publication30-Sep-2022

Correspondence Address:
Nayana Gunathilaka
Department of Parasitology, Faculty of Medicine, University of Kelaniya, Ragama
Sri Lanka

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/1995-7645.354420

Objective: To compare the DNA sequences of Leishmania (L.)donovani isolated from individuals in two districts of the Northern Province with other parts of Sri Lanka and neighboring countries.
Methods: Samples were collected from military personnel at the Army Hospital, Narahenpita, Sri Lanka from November 2018 to March 2020. A portion of the samples was fixed, stained with Giemsa and observed under the light microscope. The genomic The DNA was extracted from the remaining portion of the samples using DNEasy blood tissue kit (Qiagen, Germany) and amplified using Leishmania genus-specific primers for molecular diagnosis initially. DNA was amplified using L. donovani species-specific primers by PCR and the amplified product was sequenced for comparison of nucleotide sequences.
Results: Out of 76 suspected patients, at least one biological sample of 45 (59.2%) was positive for L. amastigotes upon microscopy. Overall, 33 (43.4%) were positive in Leishmania genus-specific PCR, but only 23 (30.3%) were positive in L. donovani specific PCR. The dendrogram indicates that the current sequences clustered together with those from Nepal and Gampaha districts (Western Province), Sri Lanka, while the Indian and Eastern African sequences clustered separately.
Conclusions: The genetic diversity was low among the isolates, indicating a single and possibly a local point of origin. However, the similarity of Sri Lankan and Nepal strains indicate a possibility of a shared point of origin, which needs more extensive evidence to confirm.

Keywords: Leishmaniasis; Sri Lanka; Phylogenetics; Kilinochchi; Mullaitivu; Northern Province

How to cite this article:
Wijerathna T, Gunathilaka N, Semege S, Pathirana N, Rodrigo W, Fernando D. Genetic diversity of Leishmania donovani isolates from cutaneous lesions of military personnel in the Mullaitivu and Kilinochchi districts of the Northern Province, Sri Lanka. Asian Pac J Trop Med 2022;15:418-24
How to cite this URL:
Wijerathna T, Gunathilaka N, Semege S, Pathirana N, Rodrigo W, Fernando D. Genetic diversity of Leishmania donovani isolates from cutaneous lesions of military personnel in the Mullaitivu and Kilinochchi districts of the Northern Province, Sri Lanka. Asian Pac J Trop Med [serial online] 2022 [cited 2022 Sep 30];15:418-24. Available from: https://www.apjtm.org/text.asp?2022/15/9/418/354420

  1. Introduction 

Leishmaniasis is a disease caused by protozoan parasites of the genus Leishmania. It is one of the major vector-borne diseases with approximately 700000 to 1 million cases each year[1]. More than 98 countries and territories are endemic to at least one form of leishmaniasis, majority of which are reported from tropical countries in South-East Asia and South America[2].

The evidence for the local transmission of leishmaniasis in Sri Lanka dates back to 1992 as per published data[3]. Since then, few sporadic cases were reported from different parts of the island until a considerable increase of patients was reported after 2002, mainly as a result of the cutaneous leishmaniasis (CL) cases reported among military personnel who were serving in conflict areas in Northern Sri Lanka[4]. In 2008, leishmaniasis was listed as a notifiable disease in Sri Lanka[5]. After 2017, the number of reported cases has been exceeding 3 000 annually[6].

The major clinical form reported from Sri Lanka is CL, while visceral leishmaniasis (VL) and muco-cutaneous leishmaniasis cases have been reported less frequently[7],[8],[9]. The causative parasite strain responsible for both CL and VL in Sri Lanka has been identified as Leishmania (L.) donovani MON-37[10]. Among 20 species of sand flies present in the country[11], Phlebotomus argentipes is considered the main suspected vector[12],[13]. Potential vectors are widely distributed around the island, making the vectors readily available to maintain the transmission cycle[11]. Thus, the free movement of infected individuals from conflict-free areas of the country may have resulted in the rapid transmission of leishmaniasis across the country.

Mullaitivu and Kilinochchi districts were highly affected by the civil conflict which lasted in Sri Lanka for over three decades, resulting in a significant displacement of inhabitants from the two areas. At the end of the civil conflict in 2009, inhabitants who had fled to South India started to return to their hometowns. It is assumed that these individuals and workers who returned to Sri Lanka from India have acted as a reservoir of infection[14]. Sand flies breed in moist soil rich in minerals and organic matter[15],[16],[17]. Seasonal irrigation systems, agricultural lands and animal husbandry create major breeding habitats for sand flies in Sri Lanka[18]. The development programmes, construction activities, newly established irrigation systems, agricultural lands and animal farms may have created environmental conditions suitable for sand fly breeding in these areas, further facilitating the transmission of the disease.

The control of leishmaniasis requires extensive knowledge of all the aspects regarding parasites, vectors and associated sociodemographic risk factors[5]. This special focus for leishmaniasis transmission has been characterized previously. However, molecular level comparison of the parasites isolated from this focus with other isolates in Sri Lanka is not yet been carried out to identify any potential differences. Therefore, the present study was conducted to compare the DNA sequences of parasites isolated from the northern districts with parasites isolated from other foci in Sri Lanka and other countries to detect the possible similarities or/and differences.

  2. Subjects and methods 

2.1. Ethics approval

The study was approved by Ethics Review Committee, Faculty of Medicine, University of Colombo, Sri Lanka (P/94/02/2019).

2.2. Study area

Both Mullaitivu and Kilinochchi districts are located in the Northern Province [Figure 1]. These areas are relatively dry with <1 250 mm rainfall annually. The average annual temperature ranges from 28 to 30 °C, with the lowest temperature in January and highest in May[19]. The dry season extends from February to September, while the wet season is from October to January.

Figure 1: Geographical location of Mullaitivu and Kilinochchi districts in Sri Lanka.

Click here to view

2.3. Sample collection and microscopic examination

The military personnel in the camps situated in the two districts were screened and individuals with lesions suspected of causing by leishmaniasis were asked to report to the Army Hospital, Narahenpita, Sri Lanka. The study was carried out from November 2018 to March 2020 with 76 individuals being referred for confirmation of diagnosis. Each individuals’ biological samples were taken using lesion aspiration, lesion scraping and tissue impression techniques following standard procedures recommended by the WHO and the Centers for Disease Control and Prevention in the US[20]. The samples taken from each biological sampling technique were fixed on the slides with methanol, stained with Giemsa and observed by a compound light microscope under 100 × magnification for the presence of amastigote forms. The microscopic observations were repeated with three observers to minimize personal errors during the diagnosis. The remaining portion of samples from the detection were transferred safely to the molecular diagnostic laboratory at the Department of Parasitology, Faculty of Medicine, University of Kelaniya, Sri Lanka for molecular analysis and stored under -20 °C until used for experiments.

2.4. Molecular detection of parasites

2.4.1. DNA extraction

The stored TIS samples were transferred to 1.5 mL tubes, separately. The genomic DNA was extracted using DNEasy blood tissue kit (Qiagen, Germany) according to the manufacturer’s instructions.

2.4.2. Genus specific amplification of the parasites

The genus-specific primers (F: GGTTCCTTTCCTGATTTACG; R: GGCCGGTAAAGGCCGAATAG) targeting small subunit ribosomal RNA (603 bp) of Leishmania spp. were used for PCR assays[21]. The amplifications were carried out in the 20 μL reaction mixture which contained 1 μL of DNA product as the template, 2 μL of 10 × CoralLoad concentrate buffer (QIAGEN) with 15 mM MgCl2 and loading dye, 10 μL of 2× HotStarTaq Plus Master mix (QIAGEN) with dNTP and DNA polymerase, 0.5 μL of 50 μΜ forward and reverse primers, and 6.6 μL of PCR water. Amplification was performed in a thermal cycler (Life ECO, Bioer) programmed for an initial denaturation step of 95 ℃ for 5 min and 40 cycles of denaturation at 94 ℃ for 30 seconds, annealing at 50 ℃ for 30 seconds, and extension at 72 ℃ for 30 seconds. Nuclease- free, PCR grade water was used as the negative control and DNA isolated from L. donovani was used as the positive control.

2.4.3. Agarose gel electrophoresis

Agarose powder (Agarose S) was used for the preparation of gels with 1× TAE. The 2% agarose gels stained with ethidium bromide (0.5 pg/mL) were prepared. A volume of 4 μL of the amplified PCR products was loaded with Promega 100 bp lambda marker and gel electrophoresis was carried out at 100 V for 25 minutes to get a good separation in the amplified products. Following the gel electrophoresis, the migrated DNA was visualized and photographed under UV illumination.

2.5. DNA sequencing and confirmation of species

The samples confirmed for Leishmania infections were selected and they were amplified using L. donovani specific primers. Oligonucleotide primers (F: AAATCGGCTCCGAGGCGGGAAAC; R: GGTACACTCTATCAGTAGCAC) targeting kinetoplast minicircle sequence (792 bp) of L. donovani were used for PCR assays[22]. The amplifications were conducted using 20 μL of the solution containing, 1 μL of DNA product as the template, 2 μL of CoralLoad Buffer (QIAGEN) with 15 mM MgCl2 and loading dye, 1.6 μL of dNTP mixture with 0.2 mM from each nucleotide, 0.06 μL of 0.3 μM forward and reverse primers, 0.41 μL of 2.5 U Mighty Amp DNA Polymerase (Takara, Japan) and 15.18 μL of PCR water. Amplification was performed in a thermal cycler (Life ECO, Bioer) programmed for an initial denaturation step of 94 °C for 5 min and 40 cycles of denaturation at 94 °C for 30 seconds, annealing at 50 °C for 60 seconds, and extension at 72 °C for 24 seconds. Nuclease-free, PCR grade water was used as the negative control and DNA isolated from L. donovani was used as the positive control.

The amplified products were visualized on agarose gel using the same methods described above to confirm the amplification. The PCR amplicons were purified using QIAquick PCR Purification Kit (QIAGEN) and purified products were sent to Macrogen, South Korea (Macrogen Inc., 1001, 254 Beotkkot-ro, Geumcheon- gu, Seoul, Republic of Korea) for sequencing by Sanger method. Chromatograms were analysed using BioEdit sequence alignment editor v7.0.9 software. The database search for homologous sequences was performed by submitting kinetoplast mini-circle sequences to the Basic Local Alignment Search Tool nucleotide server of the National Centre for Biotechnology Information (NCBI, USA).

2.6. Genetic diversity assessment and phylogenetic analysis

The consensus sequences were generated for each specimen by editing the obtained chromatograms using BioEdit 7.2 (Informer Technologies, Inc.). The DNA sequences were aligned with the Clustal W tool[23] of Molecular Evolutionary Genetics Analysis 10.0 (Pennsylvania State University)[24]. The sequences resulting from multiple alignment each sequence was compared with other mitochondrial genomes using the BLAST (NCBI, USA) program to confirm the species or genus level identity.

The DnaSP6 program[25] was used to obtain descriptive information on the sequences, such as the number of polymorphic sites and haplotypes per species. Intraspecies divergences of nucleotide sequence and composition were calculated using the Kimura 2-Parameter model[26]. A dendrogram was constructed by the neighbour-joining method after multiple sequence alignment[27] according to the genetic distances calculated via different evolutionary models. Branch support for NJ was calculated using the bootstrapping method with 1 000 replicates. The topology of the resulting phylogenetic tree was used to evaluate the species monopoly.

  3. Results 

3.1. Microscopical and molecular diagnosis

Samples were collected from 76 individuals. In 45 (59.2%) of the samples, L. amastigotes were observed by microscopy, 33 (40.8%) were detected positive by Leishmania genus specific PCR [Figure 2] and the subsequent L. donovani species specific PCR, which was done to get amplicons for sequencing, detected only 23 (30.3%) positives [Figure 3]. Among them, a total of 17 isolates resulted in clear DNA sequences, which are used for sequence analysis.

Figure 2: Results of gel electrophoresis of patient samples amplified with primers targeting small subunit ribosomal RNA of Leishmania spp. using Leishmania genus specific primers. Lane 1-6: Samples collected during the current study, Lane 7 (PC): Positive control (Leishmania donovani DNA), Lane 8 (N1): Negative control 1 (Previously negative patient sample), Lane 9 (N2): Negative control 2 (Nuclease free PCR water), Lane 10 (M): DNA molecular weight ladder, bp.

Click here to view

Figure 3: Results of gel electrophoresis of patient samples amplified with primers targeting kinetoplast minicircle sequences of Leishmania donovani. Lane 1-6: Samples collected during the current study, Lane 7 (PC): Positive control (Leishmania donovani DNA), Lane 8 (NC): Negative control (Nuclease free PCR water), Lane 9 (M): DNA molecular ladder, bp.

Click here to view

3.2. Molecular characterization

3.2.1. Nucleotide composition of L. donovani kinetoplast mini-circle DNA

The sequences obtained varied from 650 bp to 672 bp by direct sequencing. No deletions, insertions or stop codons were found, indicating that all sequences constituted functional mitochondrial products. The majority of the nucleotides consisted of adenine (A), which contributed to 35.6% of the total nucleotides, followed by cytosine (C) and thymine (T), which contributed to 33.5% and 21.2% of the total nucleotides, respectively. The guanine content was the lowest with only 9.7% relative abundance. Thus, in the sequence AT (adenine and thyamine) content is higher (mean=56.8%) relative to the GC (guanine and cytosine) content (mean=43.2%).

3.3.2. Intra-population variations

The mean genetic distance calculated with the Kimura-2-Parameter model was 0.01 for the sequences obtained during this study. The multiple alignments of nucleotides indicated the presence of only seven polymorphic sites. Three of them were singleton sites and four correspond to phylogenetically informative sites, distributed along the alignment. Only one haplotype was observed for all the sequences analyzed.

3.3.3. Phylogenetic analysis

The dendrograms generated by the neighbour-joining method [Figure 4] indicate that all the specimens collected during the current study clustered together. Interestingly, the strain isolated from Nepal and the strain L20 from Mirigama (Gampaha district, Western province) clustered with the current sequences. However, these sequences differed significantly from the strains isolated from India and Eastern Africa.

Figure 4: The dendrogram constructed for the sequences form the current study and kinetoplast minicircle sequences from other geographical areas extracted from GenBank database.

Click here to view

  4. Discussion 

This study was carried out to determine the diversity of L. donovani parasites causing cutaneous lesions among a cluster of military personnel deployed in the Mullaitivu and Kilinochchi districts of Sri Lanka using the kinetoplast minicircle sequence. Furthermore, the sequences were compared with those collected from other areas in Sri Lanka and its neighbouring countries. The results indicate a lower diversity of parasites among the cluster in this study. It clustered together with sequences from Nepal and the western parts of Sri Lanka (Mirigama), while Indian and Eastern African strains clustered as sister groups to this cluster. This indicates that the Leishmania parasites present in these areas were probably not introduced from India or Africa. It is likely to have a different route of introduction, where the source is shared with Nepal.

Although the complete suspected patients were 76, only 45 showed positive results upon microscopic examination, and only 33 patients showed positive results. Furthermore, the DNA extraction was carried out using a Spin-Column procedure to remove all the contaminants in the sample in three steps. The cycling conditions were optimized using standard optimization procedures to ensure that there are no issues with the PCR protocol. Therefore, differences among techniques could be attributed to the lower sensitivity of the genus-specific PCR at lower infection rates in some patients, rather than false positives from microscopic diagnoses. However, the PCR using L. donovani specific primers indicated positive results only for 23 samples. This may be a result of the lower sensitivity of these primers, which has been demonstrated in previous studies as well[28]. Therefore, more specific primers for Sri Lankan L. donovani strains would facilitate more extensive genetic diversity studies.

The analyzed sequences varied in length due to species differences were also observed in other studies[29]. The nucleotide composition of the kinetoplast minicircle region is slightly AT rich (the combined A and T content is higher). However, the composition is not strongly biased towards AT or GC. This is generally different from the results observed for other Leishmania species from South America[30]. The genetic distance calculated using the Kimura-2-Parameter model indicates that the genetic distance is very low (0.01). The lower intra-population diversity was also observed through the number of haplotypes and polymorphic sites. The geographical genetic variation of Sri Lanka L. donovani has been observed previously[31]. This study is also supportive of the sequences collected from Sri Lanka not being clustered apart. However, in the current study we have an additional finding by having a similarity to strains from Nepal. The lower intrapopulation genetic diversity is also evident in the neighbour-joining tree as all the specimens clustered together.

Interestingly, a single sample isolated from a patient in the Mirigama area in Sri Lanka and a sample from Nepal clustered together with the current population. This observation remains inconclusive until further studies with a much higher sample size across a wider geographical area are done. However, the Mirigama area is a newly established focus for cutaneous leishmaniasis in Western Sri Lanka[32]. The results of the current study can be used to speculate that the infection in the Mirigama area originated from the current study areas, via military force members. This may be used as evidence to facilitate further studies on the newly established focus in the Mirigama area of Sri Lanka. This also emphasizes the importance of active screening and treatment of military individuals before leaving deployed areas to prevent further spread of the disease into currently non-endemic areas. The results show that the genetic diversity was very low among the isolates. The similarity between Sri Lankan and Nepal strains indicates a possibility of a shared point of origin, which needs extensive empirical evidence to confirm.

The sample size used for DNA sequencing was lower due to the funding constraints. The lower sensitivity of the sequencing primer is another caveat in this study that further reduced the sample size in sequencing analysis. However, despite the limitations, this provides valuable information to conduct more studies highlighting the importance of further studies focusing on the diversity of L. donovani in Sri Lanka.

Conflict of interest statement

All authors declared no financial or other relationship that might lead to any conflict of interest.

Acknowledgements

We thank our study participants and Army officials who supported to carry out the field surveys. Technical Officers (Mr. Hemantha Sudasiwnghe, Mr. Varuna Nilaweera) and Mr. Udaya Wimalasiri, Temporary Demonstrator from the Department of Parasitology, Faculty of Medicine, University of Kelaniya, Sri Lanka, are greatly acknowledged. Finally, consumables shared from the National Research Council, Sri Lanka, Grant No. 16-142 for laboratory experiments greatly appreciated.

Funding

The authors received no extramural funding for the study.

Authors' contributions

NG and DF contributed to the study conception and design. SS and NP conducted the field surveys and sample collection. implemented the study. TW and NG contributed to the molecular assays, TW and WR contributed for descriptive DNA sequence analysis, phylogenetic analysis and interpretation. NG, DF and TW contributed in preparation of the manuscript. All authors have reviewed the manuscript and consent was given to publish.

 

  References 
1.World Health Organization. Leishmaniasis. [Online]. Available from: http://www.who.int/leishmaniasis/disease/en/. [Accessed on 22 May 2021].  
    2.Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, et al. Leishmaniasis worldwide and global estimates of its incidence. PLoS ONE 2012; 7(5): e35671.  
    3.Athukorale DN, Seneviratne JK, Ihalamulla RL, Premaratne UN. Locally acquired cutaneous leishmaniasis in Sri Lanka. J Trop Med Hyg 1992; 95(6): 432-433.  
    4.Siriwardana H, Chandrawansa PH, Sirimanna G, Karunaweera ND. Leishmaniasis in Sri Lanka: A decade old story. SLJID 2012; 2(2): 2-12.  
    5.Wijerathna T, Gunathilaka N, Gunawardena K, Rodrigo W. Potential challenges of controlling leishmaniasis in Sri Lanka at a disease outbreak. Biomed Res Int 2017. doi: 1 0.1155/2017/6931497.  
    6.Epidemiology Unit, Sri Lanka. Weekly epidemiology report | flashback 2019 (part I). [Online]. Available from: http://www.epid.gov.lk/web/ images/pdf/wer/2020/vol_47_no_01-english.pdf. [Accessed on 9 March 2020].  
    7.Abeygunasekara PH, Costa YJ, Seneviratne N, Ratnatunga N, Wijesundera MDS. Locally acquired visceral leishmaniasis in Sri Lanka. Ceylon Med J 2007; 52(1): 30-31.  
    8.Rathnayake D, Ranawake RR, Sirimanna G, Siriwardhane Y, Karunaweera N, de Silva R. Co-infection of mucosal leishmaniasis and extra pulmonary tuberculosis in a patient with inherent immune deficiency. Int J Dermatol 2010; 49(5): 549-551.  
    9.Siriwardana H, Udagedara C, Karunaweera N. Clinical features, risk factors and efficacy of cryotherapy in cutaneous leishmaniasis in Sri Lanka. Ceylon Med J 2011; 48(1): 10-12.  
    10.Karunaweera ND, Pratlong F, Siriwardane HVYD, Ihalamulla RL, Dedet JP. Sri Lankan cutaneous leishmaniasis is caused by Leishmania donovani zymodeme MON-37. Trans R Soc Trop Med Hyg 2007; 97(4): 380-381.  
    11.Wijerathna T, Gunathilaka N. Phlebotomine sand flies (Psychodidae: Diptera) of Sri Lanka: A review on diversity, biology and bionomics. J Insect Biodivers 2019; 11(2): 41-58.  
    12.Wijerathna T, Gunathilaka N, Gunawardena K, Fujii Y, Gunasekara D. Detection of Leishmania donovani DNA within field-caught Phlebotomine sand flies (Diptera: Psychodidae) in three cutaneous leishmaniasis endemic foci of Kurunegala District, Sri Lanka. J Trop Med 2021. doi: 10.1155/2021/6650388.  
    13.Wijerathna T, Gunathilaka N, Rodrigo W. Genetic variation of sand flies (Diptera: Psychodidae) in Gampaha and Kurunegala districts of Sri Lanka: Complementing the morphological identification. Asian Pac J Trop Med 2022; 15(7): 322-331.  
    14.Gunathilaka N, Semege S, Pathirana N, Manamperi N, Udayanga L, Wijesinghe H, et al. Prevalence of cutaneous leishmaniasis infection and clinico-epidemiological patterns among military personnel in Mullaitivu and Kilinochchi districts of the Northern Province, early war-torn areas in Sri Lanka. Parasit Vectors 2020; 13(1): 263.  
    15.Dhiman RC, Shetty PS, Dhanda V. Breeding habitats of phlebotomine sandflies in Bihar, India. Indian J Med Res 1983; 77: 29-32.  
    16.Feliciangeli MD. Natural breeding places of phlebotomine sandflies. Med Vet Entomol 2004; 18(1): 71-80.  
    17.Shortt HE, Smith ROA, Swaminath CS. The breeding in nature of Phlebotomus argentipes, ann. & brun. Bull Entomol Res 1930; 21(3): 269271.  
    18.Wijerathna T, Gunathilaka N. Diurnal adult resting sites and breeding habitats of phlebotomine sand flies in cutaneous leishmaniasis endemic areas of Kurunegala District, Sri Lanka. Parasit Vectors 2020; 13(1):284.   
    19.Department of Meteorology. Climate of Sri Lanka. 2019. [Online]. Available from: http://www.meteo.gov.lk/index.php?option=com_content&view=article&id=94&Itemid=310&lang=en. [Accessed on 23 April 2019].  
    20.Centers for Disease Control and Prevention. Specimen collection guide for laboratory diagnosis of leishmaniasis. [Online]. Available from: https://www.cdc.gov/parasites/leishmaniasis/resources/pdf/Leishmaniasis_Guide_Collection_2021.pdf. [Accessed on 23 April 2019].  
    21.Echchakery M, Chicharro C, Boussaa S, Nieto J, Carrillo E, Sheila O, et al. Molecular detection of Leishmania infantum and Leishmania tropica in rodent species from endemic cutaneous leishmaniasis areas in Morocco. Parasit Vectors 2017; 10(1): 1-8.  
    22.Salotra P, Sreenivas G, Pogue GP, Lee N, Nakhasi HL, Ramesh V, et al. Development of a species-specific PCR assay for detection of Leishmania donovani in clinical samples from patients with kala-azar and post-kala-azar dermal leishmaniasis. J Clin Microbiol 2001; 39(3): 849-854.  
    23.Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL X windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997; 25(24): 4876-4882.  
    24.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular evolutionary genetics analysis across computing Platforms. Mol Biol Evol 2018; 35(6): 1547-1549.  
    25.Rozas J, Ferrer-Mata A, Sánchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, et al. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol Biol Evol 2017; 34(12): 3299-3302.  
    26.Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980; 16(2): 111-120.  
    27.Saitou N, Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol 1987; 4(4): 406-425.  
    28.Ranasinghe S, Wickremasinghe R, Hulangamuwa S, Sirimanna G, Opathella N, Maingon RDC, et al. Polymerase chain reaction detection of Leishmania DNA in skin biopsy samples in Sri Lanka where the causative agent of cutaneous leishmaniasis is Leishmania donovani. Mem Inst Oswaldo Cruz 2015; 110(8): 1017-1023.  
    29.Kumar NP, Srinivasan R, Jambulingam P. DNA barcoding for identification of sand flies (Diptera: Psychodidae) in India. Mol Ecol Res 2012; 12(3): 414-420.  
    30.Rodrigues EHG, da Silva Soares FC, Werkhäuser RP, de Brito MEF, Fernandes O, Coutinho Abath FG, et al. The compositional landscape of minicircle sequences isolated from active lesions and scars of American cutaneous leishmaniasis. Parasit Vectors 2013; 6(1): 1-7.  
    31.Kariyawasam UL, Selvapandiyan A, Rai K, Wani TH, Ahuja K, Beg MA, et al. Genetic diversity of Leishmania donovani that causes cutaneous leishmaniasis in Sri Lanka: A cross sectional study with regional comparisons. BMC Infect Dis 2017; 1: 1-11.  
    32.Mallawarachchi CH, Chandrasena N, Wijerathna T, Dalpadado R, Mallawarachchi MSMNS, Gunarathna DGAM, et al. An investigation of a new cutaneous leishmaniasis endemic area in Western Sri Lanka. Trans R Soc Trop Med Hyg 2021; 115(11): 1288-1297.  
    

Publisher's note
The Publisher of the Journal remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]