IntroductionThe MET gene, located at chromosome 7q21-q31, encodes the widely expressed receptor of hepatocyte growth factor (HGF), which is involved in various cellular processes, including cell growth, proliferation, survival, migration, and differentiation [[1]Birchmeier C. Birchmeier W. Gherardi E. Vande Woude G.F MET, METastasis, motility and more.]. Gain-of-function alteration in MET is known as a primary oncogenic driver and a major factor for resistance to tyrosine kinase inhibitors (TKIs) in non-small cell lung cancer (NSCLC) treatment [2Frampton G.M. Ali S.M. Rosenzweig M. Chmielecki J. Lu X. Bauer T.M. et al.Activation of MET via diverse exon 14 splicing alterations occurs in multiple tumor types and confers clinical sensitivity to MET inhibitors., 3Jin W. Shan B. Liu H. Zhou S. Li W. Pan J. et al.Acquired mechanism of crizotinib resistance in NSCLC with MET Exon 14 Skipping., 4Daniel C. Callens C. Melaabi S. Bieche I. Girard N. Case report: acquired exon14 MET mutation associated with resistance to alectinib in a patient with ALK rearranged NSCLC.].The exon 14 of MET encodes the intracellular juxtamembrane domain of MET. Tyrosine 1003 (Y1003) in the juxtamembrane domain is a binding site for c-Cbl, an ubiquitin protein ligase (E3). The binding process plays a role in ubiquitination, receptor endocytosis, and degradation of MET [[5]Biology of MET: a double life between normal tissue repair and tumor progression.,[6]Schrock A.B. Frampton G.M. Suh J. Chalmers Z.R. Rosenzweig M. Erlich R.L. et al.Characterization of 298 patients with lung cancer harboring MET exon 14 skipping alterations.]. Somatic alterations of the splicing sites of MET exon 14 would cause exon skipping, which increases MET stability and enhances signaling by hepatocyte growth factor stimulation, and therefore drives oncogenesis. Mutations that cause MET exon 14 skipping (METex14) occur in approximately 3~4% of NSCLC [[8]Cancer Genome Atlas Research Network
Comprehensive molecular profiling of lung adenocarcinoma.,[9]Baldacci S. Kherrouche Z. Descarpentries C. Wislez M. Dansin E. Furlan A. et al.MET exon 14 splicing sites mutations: a new therapeutic opportunity in lung cancer.] and they rarely co-exist with other known drivers of NSCLC [[10]Frampton G.M. Ali S.M. Rosenzweig M. Chmielecki J. Lu X. Bauer T.M. et al.Activation of MET via diverse exon 14 splicing alterations occurs in multiple tumor types and confers clinical sensitivity to MET inhibitors.] except for MET amplification [[11]Tong J.H. Yeung S.F. Chan A.W. Chung L.Y. Chau S.L. Lung R.W. et al.MET amplification and exon 14 splice site mutation define unique molecular subgroups of non-small cell lung carcinoma with poor prognosis.]. However, some studies reported co-occurrence of METex14 and genomic alterations such as mutations in EGFR and CDK4 etc. [[6]Schrock A.B. Frampton G.M. Suh J. Chalmers Z.R. Rosenzweig M. Erlich R.L. et al.Characterization of 298 patients with lung cancer harboring MET exon 14 skipping alterations.,[12]Rotow J.K. Gui P. Wu W. Raymond V.M. Lanman R.B. Kaye F.J. et al.Co-occurring alterations in the RAS-MAPK pathway limit response to MET inhibitor treatment in MET exon 14 skipping mutation-positive lung cancer.]. NSCLC patients carrying METex14 may benefit from MET tyrosine kinase inhibitors including crizotinib, cabozantinib, and clumetinib [13Paik P.K. Drilon A. Fan P.D. Yu H. Rekhtman N. Ginsberg M.S. et al.Response to MET inhibitors in patients with stage IV lung adenocarcinomas harboring MET mutations causing exon 14 skipping., 14Targeting receptor tyrosine kinase MET in cancer: small molecule inhibitors and clinical progress., 15Moran-Jones K. Brown L.M. Samimi G. INC280, an orally available small molecule inhibitor of c-MET, reduces migration and adhesion in ovarian cancer cell models., 16Chen H J. Yang J J. Yang X. Zhou Q. Wu Y. et al.A phase I clinical trial to assess the safety, pharmacokinetics, and antitumor activity of gluMETinib (SCC244) in patients with advanced non-small cell lung cancers (NSCLCs).]. Capmatinib (Tabrecta, Novartis) that specifically targets METex14 has been granted accelerated approval by the Food and Drug Administration (FDA) for treating metastatic NSCLC [[17]Capmatinib: first Approval.].METex14 variations are a diverse group of DNA mutations, including nucleotide substitutions (SNV), insertions/deletions (indels), and complex events [[6]Schrock A.B. Frampton G.M. Suh J. Chalmers Z.R. Rosenzweig M. Erlich R.L. et al.Characterization of 298 patients with lung cancer harboring MET exon 14 skipping alterations.]. Based on the mutation type and chromosomal localization, METex14 is currently categorized into several subsets, such as polypyrimidine tract (PPT), acceptor splicing site, donor splicing donor site, D1010, Y1003X, PPT+ SA and DNA level whole exon deletion [[18]Awad M.M. Lee J.K. Madison R. Classon A. Schrock A.B. et al.Characterization of 1387 NSCLCs with MET exon 14 (METex14) skipping alteration (SA) and potential acquired resistance (AR) mechanism.]. Besides afore mentioned categories, emerging data has shown that other rare mutations falling within or neighboring the Y1003 motif might also impair receptor degradation. These rare missense and in-frame indels do not induce MET exon 14 skipping at RNA level and were first referred to as functional analogs [[19]Schrock A.B. Frampton G.M. Suh J. Chalmers Z.R. Rosenzweig M. Erlich R.L. et al.Characterization of 298 Patients with lung cancer harboring MET exon 14 skipping alterations.,[20]Wiesweg M. Herold T. Metzenmacher M. Eberhardt W.E. Reis H. Darwiche K. et al.Clinical response to crizotinib and emergence of resistance in lung adenocarcinoma harboring a MET c-Cbl binding site mutation.].METex14 alterations display a remarkably diverse sequence composition. Over 120 distinct point mutations and indels have been reported [[2]Frampton G.M. Ali S.M. Rosenzweig M. Chmielecki J. Lu X. Bauer T.M. et al.Activation of MET via diverse exon 14 splicing alterations occurs in multiple tumor types and confers clinical sensitivity to MET inhibitors.]. MET exon 14 skipping mutations can be detected using DNA/RNA-based hybrid capture NGS, quantitative reverse transcription polymerase chain reaction (RT-qPCR) or other less common techniques [[7]Mitiushkina N.V. Kholmatov M.M. Tiurin V.I. Romanko A.A. Yatsuk O.S. Sokolova T.N. et al.Comparative analysis of expression of mutant and wild-type alleles is essential for reliable PCR-based detection of MET exon 14 skipping., 21Davies K.D. Lomboy A. Lawrence C.A. Yourshaw M. Bocsi G.T. Camidge D.R. et al.DNA-based versus RNA-based detection of MET exon 14 skipping events in lung cancer., 22Pruis M.A. Geurts-Giele W.R.R. von der T.J.H. Meijssen I.C. Dinjens W.N.M. Aerts J.G.J.V. et al.Highly accurate DNA-based detection and treatment results of MET exon 14 skipping mutations in lung cancer., 23Kim E.K. Kim K.A. Lee C.Y. Kim S. Chang S. Cho B.C. et al.Molecular diagnostic assays and clinicopathologic implications of MET exon 14 skipping mutation in nonesmall-cell lung cancer.]. In DNA-based analysis, alterations at splicing sites (or the whole exon deletion) are classified as MET exon 14 skipping mutation, while in RNA-based analysis, fusion transcripts, observed as exon 13–15 “fusion”, serve as the standard to identify MET exon skipping [[21]Davies K.D. Lomboy A. Lawrence C.A. Yourshaw M. Bocsi G.T. Camidge D.R. et al.DNA-based versus RNA-based detection of MET exon 14 skipping events in lung cancer.]. Therefore, RNA-based confirmatory assays should be carried out for novel variants detected by DNA-based analysis.

Herein, we reported two novel METex14 variants identified in patients with stage Ia NSCLC. These two small indels are located near the donor splicing site. Although one of them impairs the Y1003 motif, both variants are analogous to canonical METex14 alterations, which lead to exon 14 skipping. By analyzing these two variants, we provided possible targeted therapy options for patients who carry these two or other similar METex14 analogs.

Materials and methods Sample information

Formalin-fixed, paraffin-embedded (FFPE) tissue sections were obtained from two patients with stage Ia NSCLC at Nanjing Drum Tower Hospital in March and July, 2020, respectively.

FFPE tissue from a 65-year-old female harboring MET c.3017_3028+15del mutation which disrupts the 3′ donor splicing site and leads to exon 14 skipping was used as a positive control, while the 293T cell line and a tissue sample without MET variations were employed as negative controls.

 Targeted NGS and data analysis

Both DNA preparation and NGS testing were conducted at 3D Medicines Inc., a College of American Pathologists (CAP)-accredited and Clinical Laboratory Improvement Amendments (CLIA)-certified laboratory. Genomic DNA was extracted using the QIAamp DNA FFPE Tissue Kit (Qiagen) and quantified by the PicoGreen fluorescence assay (Invitrogen) for each tissue sample. DNA extracts (50–200 ng) were fragmented to around 200 bp by sonication (Covaris), and libraries were prepared using the KAPA Hyper Prep Kit (Kapa Biosystems) according to the manufacturer's protocol. The libraries were then subjected to hybridization with probes targeting a panel of 381 cancer-related genes panel was to capture the targeted genomic regions, followed by sequencing on an Illumina NextSeq 550 instrument.

Sequencing reads were mapped against the human reference genome (hg19/GRCh37) with BWA version 0.7.12 and SAMtools version 1.3. Duplicate reads were removed using Picard version 1.130. Variant calling in targeted regions was performed using an in-house developed algorithm, with the filtering model containing background error correction, strand bias, base quality, mapping quality, short tandem repeat regions and low-quality mapping ratio 25.

We used a Bayesian methodology to detect novel somatic mutations and the de Bruijn approach to detect indels. In-house developed BIC-seq (Bayesian information criterion) algorithm was applied to detect copy number variations (CNVs). The reliability of NGS detection has been validated in reference to conventional molecular diagnostic methods. The sensitivity and specificity of SNV and indel detection are 100%. The concordance of CNV detection between NGS and fluorescence in situ hybridization (FISH) was up to 93.3% [[24]Su D. Zhang D. Chen K. Lu J. Wu J. Cao X. et al.High performance of targeted next generation sequencing on variance detection in clinical tumor specimens in comparison with current conventional methods.]. Sanger sequencing and quantitative reverse transcription PCR

Total RNA was isolated from FFPE samples using the ReliaPrep™ FFPE Total RNA Miniprep System (Promega) according to the manufacturer's protocol. For cDNA preparation, 100 ng of total RNA from each sample was reverse-transcribed using the SuperScript™ VILO™ cDNA Synthesis Kit (Invitrogen). The primers for Sanger sequencing and RT-qPCR in validation of MET exon 14 skipping were as follows: forward primer for exon 13 of MET (13F), 5′- TTGGGTTTTTCCTGTGGCTG -3′; reverse primer for exon 15 of MET (15R), 5′- GCATGAACCGTTCTGAGATGAATT -3′. DNA fragments separated in agarose gel were excised and subjected to PCR amplification, followed by Sanger sequencing. RT-PCR was performed on the Applied Biosystems 7500 Real-Time PCR Machine under the following cycling conditions: 95°C for 2 min, 45 cycles of 95°C for 15 s, 54°C for 15 s, 72°C for 1 min.

DiscussionIn this study, we detected two METex14 analogs in NSCLC patients. The METex14 analog was first defined as genomic alterations located in the exon 14 of the MET gene without affecting acceptor splicing site or donor splicing site. Bioinformatics algorithms annotate these variants as C-terminal truncated proteins (P1008Lfs*20 in Patient 1 and D1002Tfs*5 in Patient 2). Since MET mutation is a well-characterized oncogenic driver in NSCLC [[25]Chiara F. Michieli P. Pugliese L. Comoglio P.M. Mutations in the MET oncogene unveil a “dual switch” mechanism controlling tyrosine kinase activity.,[26]MET receptor juxtamembrane exon 14 alternative spliced variant: novel cancer genomic predictive biomarker.] and these two cases lacked other known oncogenic factors, we further analyze the potential oncogenicity of rare MET alterations.Coding-region nucleotide changes within exonic splicing enhancers (ESEs, a purine-rich DNA sequence and often within 30 base pairs of the exon boundary) may affect the patterns or efficiency of mRNA splicing [[27]The association of nonsense codons with exon skipping.,[28]Disset A. Bourgeois C.F. Benmalek N. Claustres M. Stevenin J. Tuffery-Giraud S. An exon skipping-associated nonsense mutation in the dystrophin gene uncovers a complex interplay between multiple antagonistic splicing elements.], which cause skipping of constitutive exons. Coding-region nucleotide changes, including deletions and substitutions, are sometimes incorrectly annotated as nonsense, missense or silent mutations [27The association of nonsense codons with exon skipping., 28Disset A. Bourgeois C.F. Benmalek N. Claustres M. Stevenin J. Tuffery-Giraud S. An exon skipping-associated nonsense mutation in the dystrophin gene uncovers a complex interplay between multiple antagonistic splicing elements., 29The regulation of splice-site selection, and its role in human disease., 30D'Souza I. Poorkaj P. Hong M. Nochlin D. Lee V.M. Bird T.D. et al.Missense and silent tau gene mutations cause frontotemporal dementia with parkinsonism-chromosome 17 type, by affecting multiple alternative RNA splicing regulatory elements., 31Vuillaumier-Barrot S. Barnier A. Cuer M. Durand G. Grandchamp B. Seta N. Characterization of the 415G>A (E139K) PMM2 mutation in carbohydrate-deficient glycoprotein syndrome type Ia disrupting a splicing enhancer resulting in exon 5 skipping., 32Liu H.X. Cartegni L. Zhang M.Q. Krainer A.R. A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes., 33Okubo M. Noguchi S. Hayashi S. Nakamura H. Komaki H. Matsuo M. et al.Exon skipping induced by nonsense/frameshift mutations in DMD gene results in Becker muscular dystrophy.]. When the two variants were annotated as premature termination, the c-terminal truncated MET product would be interpreted as functional loss. However, considering these variants might change mRNA splicing efficiency, exon skipping product would cause MET activation. The two METex14 analogs cause MET exon 14 skipping by changing the ESE region.RNA-based confirmation demonstrated that the two non-classical mutations cause exon 14 deletion of MET. The major peak in melt curves indicated the METex14 RNA transcript and the small peak next to it corresponded to the wild-type MET transcript. For Patient 2, mature RNA of the mutant allele was detected at much higher abundance than the wild-type allele, given the much smaller wild-type peak in the melting curves. This phenomenon indicated that METex14 carriers tend to have a lower expression level of non-truncated MET. This is consistent with previous findings by The Cancer Genome Atlas project [[34]Seo J.S. Ju Y.S. Lee W.C. Shin J.Y. Lee J.K. Bleazard T. et al.The transcriptional landscape and mutational profile of lung adenocarcinoma.].

The efficacy of MET-targeting therapies varies due to the patients’ clinical complexity as well as the interpretation of MET genomic alterations. Potential oncogenic variants identified by any diagnostic approach should not be ignored. Combining DNA-based and RNA-based techniques will better inform treatment decision. Based on the presented evidence, the patients may be eligible for MET-targeting therapies upon disease recurrence.