Abstract

Background: Triple-negative breast cancer (TNBC) is characterized by a substantial presence of tumor-associated macrophages (TAMs) exhibiting an M2-like phenotype, which plays a crucial role in promoting tumor cell stemness and invasiveness. Mesenchymal stem cells (MSCs) have the ability to induce the transformation of naive macrophages (M0) into M1-like macrophages. This study delves into the interplay between MSCs and macrophages within the context of breast cancer (BC) progression using a TNBC cell line, as reprogramming of TAMs into M1-like macrophages may emerge as a promising therapeutic strategy for BC.

Methods: THP-1 cells were induced into M0 macrophages and co-cultured with UC-MSCs, subsequently analyzing CM for M1- and M2-type macrophage-related cytokines. Total RNA from co-cultured cells was used to assess IRF-4 and IRF- 5 mRNA gene expression via qRT-PCR. MDA-MB-231 cells were exposed to CM and co-cultured cells to evaluate cell viability through MTT assay over 24, 48, and 72 hours, with qRT-PCR used to examine breast cancer-related gene expression.

Results: The results indicate that co-culturing M0 macrophages with MSCs promotes M1-like macrophages, as evidenced by upregulated IRF- 5 and suppressed M2 macrophage-related genes. Treatment with CM from M0/MSCs co-culture significantly inhibits MDA-MB-231 cell proliferation at 72 hours, accompanied by reduced TNF-alpha levels. Notably, CM treatment downregulates AKT1 and YKL-39 genes in MDA-MB-231 cells, suggesting potential anti-cancer effects. Direct co-culture with M0/MSCs, however, shows no significant impact on TNBC cell growth.

Conclusion: This study highlights MSCs' ability to induce M0 macrophages to a M1-like phenotype and suggests that CM from M0/MSCs co-culture may contain anti-cancer factors targeting AKT1 and YKL-39 genes, underscoring the potential of MSC-mediated macrophage activation as a strategy to enhance BC treatment, especially in the context of TNBC.

Introduction

Breast cancer (BC) is the primary factor responsible for fatalities in women, with approximately 2.3 million newly diagnosed cases and 685,000 reported deaths worldwide in 20201. The mortality rate of BC is significant, contributing to 16% or 1 in every 6 cancer-related deaths in females. The main reason is primarily attributed to the spread of the disease to other parts of the body and the challenge of overcoming systemic treatments1. In the beginning, research into BC metastasis and treatment resistance primarily focused on tumor cells alone. Nevertheless, recent years have witnessed thorough investigations into how the tumor microenvironment (TME) contributes to advancing distant metastasis and resistance to therapy2. This shift in focus has revealed the significance of non-malignant cells and TME components, such as immune cells and the extracellular matrix, in BC progression3. As a result, diverse approaches have undergone investigation to target these non-malignant cells and TME constituents, aiming to disrupt the tumor-promoting environment and enhance treatment outcomes3. By understanding the complex interplay between tumor cells and their microenvironment, novel therapeutic approaches can be developed to combat BC metastasis and overcome treatment resistance, offering new hope for patients worldwide.

In normal physiological conditions, tissue-resident macrophages serve as innate immune cells that contribute to phagocytic capability, sustaining tissue homeostasis, and defending against pathogens4. However, in the context of BC, tumor-associated macrophages (TAMs) heavily infiltrate the TME, comprising over 50% of the cell population within the TME4. The TME in BC consists of various components, including adipocytes, fibroblasts, and various categories of leukocytes such as dendritic cells, lymphocytes, and neutrophils5. The recruitment of circulating monocytes and resident macrophages sustains the population of TAMs in BC6. Upon recruitment, monocytes differentiate into naïve macrophages (M0) under the stimulation of monocyte colony-stimulating factor6. Macrophages can polarize into two main phenotypes: M1-like macrophages, also known as classically activated macrophages, and M2-like macrophages, also referred to as alternatively activated macrophages7. M1-like macrophages are stimulated by T helper 1-type cytokines such as interferon gamma (IFNγ) or tumor necrosis factor-alpha (TNF-α) and exhibit anti-tumor responses. They secrete pro-inflammatory cytokines like TNF-α and IL-2, along with reactive nitrogen and oxygen intermediates7. Conversely, M2-like macrophages are induced by T helper 2-type cytokines such as IL-4, IL-10, and IL-13 and demonstrate pro-tumor responses7. Under the influence of specific stimuli, various subtypes of M2a, M2b, M2c, and M2d can be induced from M2-like macrophages8. In the TME, cancer cells release cytokines that attract TAMs, which closely resemble M2 macrophages9. TAMs, in turn, impede the invasion and role of anti-tumor CD8+ T cells (CTLs), promote tumor angiogenesis, and stimulate tumor cell proliferation and metastasis9. The most effective strategy in cancer prevention research has recently shifted from macrophage reduction to TAM re-education10. Due to their great ability and flexibility to adjust to external signals, macrophages can have their biological functions taken over and altered in cancer10. It is crucial to evaluate TAMs holistically, considering their ontogeny, TME-mediated education, phenotypic diversity, placement within the TME, and tumor-modulating roles10. Consequently, targeting the recruitment of TAMs or reconfiguring them into a phenotype competent to eliminate tumor cells has emerged as a potential therapeutic approach in BC.

Mesenchymal stem cells (MSCs) belong to the mesoderm lineage and encompass various multipotent cells, including adipocytes, chondrocytes, fibroblasts, osteoblasts, and smooth muscle cells, among others11. MSCs are characterized by the expression of CD73, CD90, and CD105, while lacking hematopoietic lineage markers such as CD14, CD20, CD34, CD45, and HLA-DR11. Extensive evidence suggests that MSCs foster the advancement of cancer via numerous avenues, encompassing the stimulation of blood vessel formation, infiltration, proliferation, viability, the creation of carcinoma-associated fibroblasts, and the hindrance of natural and acquired anti-tumor reactions12. However, MSCs may even inhibit tumor growth. MSC-CM has been shown to limit breast cancer cell proliferation and make cancer cells more sensitive to radiation by suppressing the STAT3 signaling pathway13.

The relationship that exists between tissue-draining macrophages and allogeneic MSCs has been explored, in which the macrophages were transformed into regulatory macrophages that inhibited T cell responses in vivo14. Recent research indicates that the interaction between MSCs and macrophages can promote macrophage polarization to the M2-like phenotype when triggered in the M1 activation stage15. MSC-derived soluble factors can convert monocytes or M1 macrophages into M2 cells, with PGE2 playing a significant role16. Additionally, a study by Vasandan et al. revealed that MSCs induce respiratory burst and nitric oxide-dependent killing mechanisms in macrophages17. MSCs altered naïve macrophages towards a pro-inflammatory M1 polarized state, as demonstrated by increased TNFα secretion and decreased levels of DC-SIGN and M2-associated IL-1017. Co-culturing naïve primary macrophages with MSCs stimulated CD86 expression, attributing a shift towards M1-like macrophages17. Moreover, the study also showed that the co-culture of MSCs with M1-like macrophages led to a reduction in inflammatory M1-like macrophages, accompanied by a shift towards M2-like macrophages17. Conversely, the co-culture of MSCs with M2-like macrophages further enhanced the M2 polarization14. Vasandan et al. concluded that MSC-secreted factors at the MSC-macrophage interface repolarize macrophages by modifying metabolic patterns in variably polarised macrophages17. To date, there has been a strong focus on identifying TAMs in the 'either/or' M1 or M2 state, sometimes disregarding other theories10. A new study found the expression of both M1 and M2 genes in identical cells18. Interestingly, Rabani et al. discovered that when MSCs were exposed to M0 macrophages, they produced both M1-like and M2-like macrophage phenotypes simultaneously18. From the study, M2-like macrophages showed elongated morphology, were CD163+, had acute phagosomal acidification, low NOX2 expression, and limited phagosomal superoxide production while the M1-like macrophages produced high levels of phagosomal superoxide but with low or undetectable levels of CD4018. Prostaglandin E2 and phosphatidylinositol 3-kinase were essential for promoting the M1-like macrophages18. Because TAMs are highly abundant in tumors, more research is necessary to understand how MSC and macrophages interact to regulate the activation state of macrophages, which will aid in the development of an effective therapeutic strategy for breast cancer.

The present study aims to repolarize M1-like macrophages within the BC microenvironment by co-culturing UC-MSCs with M0 macrophages. Subsequently, the influence of the M0 macrophages co-cultured with UC-MSCs was explored by treating MDA-MB-231 cells with conditioned medium from the co-culture of UC-MSCs with M0 macrophages. In parallel, M0 macrophages treated with MSCs were also cultured directly with MDA-MB-231 to evaluate their effect on TNBC cell growth and their mechanism of action. Repolarizing M1-like macrophages with MSCs may enhance anti-tumor responses and inhibit TAMs, which exhibit pro-tumor responses in the BC microenvironment.

Methods Materials

Human umbilical cord mesenchymal stem cells (UC-MSCs), human THP-1 cells, and the MDA-MB-231 cell line were procured from the American Type Culture Collection (ATCC, USA). Roswell Park Memorial Institute (RPMI)-1640 medium, Dulbecco's Modified Eagle Medium/F12 (DMEM/F12), fetal bovine serum (FBS), penicillin and streptomycin (Pen-Strep), phorbol 12-myristate 13-acetate (PMA), lipopolysaccharide (LPS), and phosphate-buffered saline (PBS) were secured from Thermo Fisher Scientific (USA).

Culturing UC-MSCs, THP-1 cells, and MDA-MB-231 cells

UC-MSCs were cultured in DMEM/F12 media containing L-glutamine and sodium bicarbonate, 10% FBS, and 1% Pen-Strep in a 37°C incubator with 5% CO2. UC-MSCs between passages 7–10 were used for all the experiments. THP-1 cells were grown in RPMI1640 media containing L-glutamine and supplemented with 10% FBS and 1% Pen-Strep. THP-1 cells were incubated with 20 nM PMA for 48 hours to differentiate them into naïve macrophages (M0). The influence of UC-MSCs on M0 macrophage differentiation into M1 and M2 macrophages was assessed by culturing both cell types together in 6-well culture plates (CORNING, USA), physically separated by cell-culture inserts (0.4 microns, CORNING, USA) for 30 hours. 3.5 × 105 THP-1 cells were used for differentiation experiments, and 3.5 × 104 MSCs were seeded on culture inserts in co-culture conditions17. The ratio was established by considering the proportions of MSCs inducing immune suppression in MLRs, as previously reported by Vasandan et al.17. The respective conditions for co-culture of UC-MSCs with M0 macrophages were untreated M0 macrophages, LPS-treated M0 macrophages, UC-MSCs co-cultured with M0 macrophages, and UC-MSCs co-cultured with LPS-treated M0 macrophages for 30 hours. The conditioned medium (CM) from respective treatments was used to treat MDA-MB-231 cells for 72 hours. Meanwhile, the cells from respective treatments were directly co-cultured with MDA-MB-231 cells for 72 hours.

UC-MSCs Immunophenotyping

UC-MSCs and UC-MSCs co-cultured with M0 macrophages for 30 hours with respective treatments were evaluated for their surface markers using the BD Stemflow™ Human MSC Analysis Kit (BD Bioscience, USA) based on the manufacturer's instructions. Briefly, both types of UC-MSCs were suspended in a tube containing at least 1 × 105 cells each in 100 µl of BD Pharmingen™ stain buffer. The cells were mixed with the appropriate monoclonal antibodies for anti-human CD105 (conjugated with PerCP-Cy™5.5), CD73 (conjugated with APC), CD90 (conjugated with FITC), CD19, CD11beta, CD45, CD34, and HLA-DR (all negative markers conjugated with PE) or the respective isotype control. Cells stained with isotype control from the kit and unstained cell suspension were used as controls. The antibodies were included at concentrations recommended by the manufacturers, and the samples were left to incubate away from light for 30 minutes at 2–8 ℃. The samples were then washed twice with PBS and analyzed on a NovoCyte Advanteon Flow Cytometer (Agilent, USA), recording at least 10,000 events per sample. The obtained data were further analyzed using NovoExpress software.

Enzyme-Linked Immunosorbent Assay (ELISA)

TNF-α and IL-10 were quantified in the supernatants of untreated and respective treated M0 macrophages at each treatment time using the TNF-α and IL-10 DuoSet ELISA kit (R&D Systems, USA) according to the guidelines stated by the manufacturer. Firstly, a 96-well ELISA plate was coated with either TNF-α or IL-10 capture antibodies, respectively, and incubated overnight at 4°C. The plate was washed with wash buffer (400 µl) three times. Subsequently, diluent buffer was added to block the plate and incubated at room temperature for one hour. The blocking buffer was pipetted out, and the washing step was repeated as previously. Standards were prepared by diluting them in reagent diluent for a total of seven points, and both samples and diluted standards (100 µl) were added into respective wells of the plate. The plate was sealed properly and incubated overnight at 4°C. The plate was washed with wash buffer three times post-incubation. Next, TNF-α or IL-10 detection antibodies (100 µl) were added and incubated for 2 hours at room temperature. The detection antibodies were then aspirated, and the washing step was repeated. Subsequently, Streptavidin-HRP (100 µl) was added to each well, and the plate was left at room temperature for a 20-minute incubation period. The aspiration and washing steps were repeated. Finally, substrate solution (100 µl) was added to each well and then incubated for 20 minutes at room temperature. The reaction was terminated by adding stop solution (50 µl) and the optical density of each well was evaluated immediately using a FLUOstar Omega microplate reader (BMG Labtech, Germany) set to 450 nm and 570 nm for wavelength correction.

MTT Assay

The anti-cancer activity of both direct cell-cell interaction and CM of M0 macrophages co-cultured with UC-MSCs (M0/MSCs) on MDA-MB-231 cells was determined by the MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide) assay. For the effect of CM, MDA-MB-231 cells (5 × 103/well) were plated in 96-well plates 24 hours before treatment. During treatment, the old medium from the wells was removed and replaced with CM from M0/MSCs (100 µl). For direct cell-cell effect, MDA-MB-231 cells (5 × 103/well) and M0/MSCs cells (5 × 103/well) were seeded together in the well. Both MDA-MB-231 cells for either CM or direct cell-cell treatment were incubated at 24, 48, and 72 hours. Post-treatment, the old media was removed and new media (90 µl) and MTT (10 µl) were added into each well. The MTT assay (Invitrogen, USA) was initially prepared by dissolving in PBS at 5 mg/ml. The plates were incubated at 37°C with 5% CO2 for 3 hours and the medium was then replaced with 100 μL DMSO. The plates were then incubated for 10 minutes at 37°C with 5% CO2 and the absorbance for each well was measured at 570 nm using an ELISA microplate reader.

Total RNA Extraction and cDNA synthesis

Total RNA was extracted from MDA-MB-231 cells cultured with CM of M0/MSCs (in a ratio of 1:1 with fresh culture media) and MDA-MB-231 cells that directly co-cultured with M0/MSCs for 72 hours using TRIsure™ (Bioline, UK) following the instructions stated by the manufacturer. NanoDrop (Thermo Fisher Scientific, USA) was used to evaluate the concentration and purity of RNA with an A260:A280 ratio of 1.7–1.9 obtained, demonstrating isolated samples were high-quality RNA with low levels of protein contamination. RNA integrity was assessed by conducting agarose gel electrophoresis with the presence of 28S and 18S rRNA bands. Then, RNA (2 μg) was reverse transcribed into cDNA using the Tetro cDNA Synthesis kit (Bioline, UK) based on instructions stated by the manufacturer. Briefly, the reaction conditions were as follows: 2 μg of RNA, 4 μL of 5x RT buffer, 1 μL of Oligo (dT)18 primer mix, 1 μL of dNTP mix 10 nM, 1 μL of RNase inhibitor, 1 μL of (200 U/μL) reverse transcriptase, and DEPC water to a final volume of 20 μL. Samples were mixed and placed at 45°C for 30 minutes incubation, followed by incubating at 85°C for 5 minutes to terminate the reaction and chilled on ice.

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Relative mRNA expression levels were detected via qPCR assays on a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). All PCR reactions were carried out in triplicates using a SensiFAST SYBR Hi-Rox Kit (Bioline, UK). Reactions were set up in a final volume of 20 μL containing: 10 μL 2x SensiFAST SYBR® Hi-ROX Mix, 0.8 μL of each primer pair mixture [10 μM of each primer], 2 μL of cDNA and 6.4 μL of nuclease-free water to make up the total volume. All primer sequences are displayed in Table 1. The three-step cycling conditions included an initial polymerase activation at 95°C for 2 minutes, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing, and extension at 60°C for 10 seconds and 75°C for 5 seconds, respectively. The assessment of mRNA expression levels relative to GAPDH, used as the reference gene, was executed through the ΔΔCt method. To achieve relative quantification, we employed the 2−ΔΔCt method.

Table 1.

Sequences of the primers used for q-PCR analyses

Gene Forward (5’-3’) Reverse (5’-3’) GAPDH AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA CD80 CACTTCTGTTCAGGTGTTATCC GGTGTAGGGAAGTCAGCTTTG CD163 ACATAGATCATGCATCTGTCATTTG CATTCTCCTTGGAATCTCACTTCTA IRF-5 TTCTCTCCTGGGCTGTCTCTG CTATACAGCTAGGCCCCAGGG IRF-4 GCTGATCGACCAGATCGACAG CGGTTGTAGTCCTGCTTGC TNF-α CCTCTCTCTAATCAGCCCTCTG GAGGACCTGGGAGTAGATGAG IL-10 TACGGCGCTCGTCATCGATTT TAGAGTCGCCACCCTGATGT Akt1 GAAGGACGGGAGCAGGCGGC CCTCCTCCAGGCAGCCCT mTOR AGTGGACCAGTGGAAACAGG TTCAGCGATGTCTTGTGAGG YKL-39 AAGATGACCTTGCTGCCT TGATCTAAGAGGAAGTCAGG P53 CCCCTCCATCCTTTCTTCTC